Their corresponding negative controls was 50 nmol/l. Twenty-four hours later, cells were harvested to evaluate the transfection efficiency. Then, successfully transfected cells were used for the following experiments. For miR-138 inhibitor, the single-stranded RNA sequence was 5-CGGCCUGAUUCACAACACCAGCU-3. 5- CAGUACUUUUGUGUAGUACAA-3 was the sequence of its corresponding negative control. For miR-138 mimics, the sequences of oligonucleotides were 5-AGCU GGUGUUGUGAAUCAGGCCG-3 (sense), and 5-GCC UGAUUCACAACACCAGCUUU-3(antisense). And the sequences were 5-UUCUCCGAACGUGUCACGUT T -3(sense) and 5- ACGUGACACGUUCGGAGAA TT-3 (antisense) for its negative control.qPCRto the manufacturer’s protocol. The reverse transcription primer for miR-138 was 5-GTCGTATCCAGTGCA GGGTCCGAGGTATTCGCACTGGATACGACCGGC CT-3, and primer for small nuclear RNA U6 was 5- GTCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGATACGACAAAATA-3. The mature miR138 level was normalized with U6 determined by qPCR, as described previously. Primers sequences were as follows: miR-138 forward: PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28549975 5-AAGCGGAGCTGGTGTTGTGAATC-3, reverse: 5- ATCCAGTGCAGGGTCCGAG G-3; U6 forward: 5-AGAGAAGATTAG CATGGCCC CTG-3, reverse: 5-ATCCAGTGCAGGGTCCGAGG-3.WB analysisWB analysis was performed as described previously [11]. Briefly, cell protein was extracted using Mammalian Protein Extraction Reagent (Thermo Scientific, Pittsburgh, PA, USA) supplemented with 1 protease inhibitor cocktails (Sigma-Aldrich, Hamburg, Germany). Protein concentration was measured using a BCA protein assay kit (Thermo Scientific). The protein samples (10?0 g) were separated by 12 SDS-PAGE, transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA) and then detected with appropriate primary and secondary antibodies. Protein bands were visualized by chemiluminescence (Thermo Scientific) and scanned via a Kodak Image Station (Carestream Health, Inc., Rochester, New York, USA). The primary antibodies used were goat antiANGPTL1 polyclonal antibody (1:1000, R D Systems, Minneapolis, MN, USA) and rabbit anti-GAPDH monoclonal antibody (1:1000, Cell Signaling Technology, Beverly, MA, USA).Transwell migration and invasion assayTotal RNA from cells and fresh human tissues was isolated using RNAiso reagent (Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions. The SIS3 site quality and quantity of RNA were evaluated using NanoDrop 1000 spectrophotometer (Thermo Scientific, Pittsburgh, PA, USA). cDNA was synthesized with PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara Biotechnology). To validate the mRNA expression profiles, qPCR was performed using a standard SYBR-Green PCR kit protocol (Takara Biotechnology) with the StepOne Plus Real Time PCR System (Life Technologies). The primers were synthesized by Sangon Biotech (Shanghai, China), and the sequences were as follows: ANGPTL1 forward: 5-CAACATATTCCTAACAGCC AACAG -3, reverse: 5-TGACAGTCTTTGAATGGT CCTTC -3; GAPDH forward: 5- TCTCTGCTCCTC CTGTTCGA -3, reverse: 5- GCGCCCAATACGACC AAATC -3. All PCR reactions were performed in triplicate. GAPDH was used as an internal control. For quantifying mature miR-138, reverse transcription was performed using a miRNA 1st Strand cDNA Synthesis kit (Sangon Biotech, Shanghai, China) accordingCells resuspended in 200 l serum-free medium were seeded in the upper chamber with 10 serumcontaining medium in the lower chamber of 24-well transwell plates (Corning Inc., NY, USA). After 48 or 72 h, the non-invaded cells in the upper chamber were removed wi.