Echniques of high sensitivity and accuracy to investigate the endogenous processing
Echniques of higher sensitivity and accuracy to investigate the endogenous processing and presentation of this and also other HLA-B27-restricted peptides from ClpC and other chlamydial proteins. Molecular dynamics simulations had been also carried out to analyze the connection involving chlamydial and homologous human-derived B27 ligands at the conformational level.EXPERIMENTAL PROCEDURESClpC Gene Constructs–Enhanced GFP (EGFP)-ClpC fusion proteins were generated by fusing the cDNA of the clpC gene (CT286) of C. trachomatis serovar L2 (Sophisticated Biotechnologies, Columbia, MD) or truncated forms of it in frame for the three -end on the EGFP gene. Full-length cDNA of ClpC was amplified by PCR utilizing the following primers: five – CTCTCTCTAGATCTATGTTTGAGAAGTTTACCAATCG and 3 -CTCTCTCTGTCGACCTATGATTCATCAGCTGTAATAG. The PCR products have been cloned into the pEGFP-C1 vector (BD Biosciences, Clontech) making use of 5 BglII and 3 SalI restriction web pages. Two constructs have been produced depending on the EGFP-CT286 plasmid sequence plus the internal restriction web sites BglII at five and ApaI and EcoRI at 3 , respectively. Cell Culture and Transfections–Stable transfectants have been generated as described previously (38). Briefly, The EGFPClpC constructs were co-transfected by electroporation in C1R-B27:05 cells (40), using the RSV5 vector (41) containing the hygromycin resistance gene. The transfected cells were selected with 250 gml hygromycin (Invitrogen). All cell lines have been cultured in RPMI 1640 medium, supplementedJOURNAL OF BIOLOGICAL CHEMISTRYChlamydial HLA-B27 Ligandswith 10 FBS, 200 mM L-Gln, 25 mM HEPES, streptomycin, and penicillin. Flow Cytometry–The C1R transfectants were analyzed by measuring their EGFP-associated fluorescence. Briefly, 1 106 cells have been washed twice with 200 l of PBS and centrifuged at 1500 rpm for 5 min. The detection was carried out inside a flow cytometer FACSCalibur (BD Biosciences). All information had been acquired applying CellQuestTM Pro version 4.0.2 computer software (BD Biosciences) and analyzed employing FlowJo version 7.five (Tree Star, Inc.). Immunoprecipitation and Western Blot–About 2 106 cells have been lysed in 0.5 Igepal CA-630 (Sigma), five mM MgCl2, 50 mM Tris-HCl, pH 7.4, containing protease inhibitors (Full Mini, Roche Applied Science) for 30 min. Just after centrifugation, the lysate supernatants were precleared with anti-rabbit IgG beads (TrueBlot, eBioscience, San Diego, CA) and immunoprecipitated for three h using the rabbit anti-GFP polyclonal antibody (A6455) (Invitrogen) coupled to anti-rabbit IgG beads, at 4 and continuous shaking. Immunoprecipitates had been washed three occasions, denatured for 5 min in sample buffer, subjected to 10 SDS-PAGE, and transferred overnight to a nitrocellulose membrane (CDK3 manufacturer Amersham Biosciences Hybond-ECL, GE Healthcare) at 20 V and 4 . The Kinesin-7/CENP-E drug immunodetection was carried out working with the A6455 antibody and horseradish peroxidase-conjugated anti-rabbit IgG (TrueBlot, eBioscience, San Diego, CA) at 1:1000 and 1:5000 dilutions, respectively. Antibodies were diluted in blocking buffer containing five nonfat dry milk, 0.1 Tween 20, PBS, pH 7.4. The immunoblots had been developed utilizing the ECL immunodetection program (Amersham Biosciences). Isolation of HLA-B27-bound Peptides–B27:05-bound peptides were isolated from about 1 1010 cells or, for some analyses, 1 109 C1R-B27:05 cells, as described previously (42). Briefly, cells have been lysed within the presence of a mixture of protease inhibitors (Total, Roche Applied Science). The soluble fraction was subjected to affinity chromatogr.