. (Rocky Hill, NJ) were used at 1,000 U/mL and 10 ng/mL, respectively. 4-Hydroxytamoxifen was from Sigma-Aldrich (St. Louis, MO). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 5 fetal bovine serum. IKK–null cells were a gift from Dr. Michael Karin. IRF1-null MEFs and their wild-type counterparts were a gift from Dr. Tadatsugu Taniguchi.Quantitative real-time PCRTotal RNA was isolated from cells by using Trizol (Invitrogen, Carlsbad, CA). Two micrograms of RNA was treated in a 20 L buy ML240 reaction mixture containing two units of DNAse I (Invitrogen) for 15 min at 25 ; 2 L of 25 mM EDTA was added and the reaction was placed at 65 for 10 min. cDNA was synthesized from 8 L of the DNAse-treated RNA reaction mixture (0.75 g) by using the random priming procedure with the SuperScript II First Strand ML240 price Synthesis Kit (Invitrogen). The final cDNA reaction mixture (20 L) was diluted 10-fold and 5 L was used as a template for PCR. Primer sequences were developed using the PerlPrimer program. The forward primer, gagagtcaggagaaagggcga, anneals within the first intron of ip-10. The reverse primer, gcaacttgtcagttacgaaatcct, anneals within the first exon. Amplicons were designed to be 100 to 200 base pairs long and to overlap a splice site. Primers were then tested in serial dilutions of cDNA to assure 90 ?00 efficiency. Real-time PCR was performed by using 500 nM of primers, 5 L of diluted cDNA sample, and 10 L of iQ SYBER Green Supermix (BioRad, Hercules, CA). jir.2012.0140 All samples were amplified in triplicate and normalized against gapdh. Amplification was performed by using a BioRad iCycler IQ real-time PCR Ornipressin price instrument. Parameters for amplification were: 95 for 3 min, followed by 40 cycles at 95 for 30 s, 65 for 30 s, and 72 for 30 s. The initial amplicon for each primer was assayed by melt curve analysis and agarose gel electrophoresis and all subsequent amplifications with that primer set were assayed by melt curve analysis after 40 cycles.Retroviral transductionBosc packaging cells were transfected with pBabeHygroIKK- using Lipofectamine Plus (Invitrogen, Carlsbad, CA). Virus-containing supernatant medium, collected 24 and 48 h later, was passed through a 0.2 M filter and combined with 5 g/mL of polybrene. Equal parts of filtered virus and fresh medium were then used to infect cells. Twenty-four hours after the final round of virus treatment, IKK–null cells were seeded at 20 confluence and grown in journal.pone.0158910 antibioticcontaining medium for selection.Western analysisAfter treatment, cells at 90 confluence in 100-mm dishes were washed twice with phosphate-buffered saline (PBS), scraped into Eppendorf tubes, and lysed for 10 min in a buffer containing 1 Triton X-100, 50 mM Tris HCl, pH 8, 150 mM NaCl, 10 mM sodium fluoride, 5 mM sodium pyrophosphate, 10 mM orthovanadate, 1 mM leupeptin, 10 mM aprotonin, and 1 mM phenylmethanesulfonyl fluoride. Cellular debris was removed by centrifugation at 16,000g for 10 min. Cell extracts were fractionated by electrophoresis in 10 SDS-PAGE gels and transferred to PVDF membranes. Anti-mouse IRF1 (M-20), p65, and anti-histone antibodies were from Santa-Cruz (Santa Cruz, CA).Chromatin immunoprecipitation (ChiP) assaysThese assays were performed as described (Sakamoto and others 2004). In brief, MEFs were untreated or treated as described, fixed in 1 formaldehyde, resuspended in POR-8 site SDS-containing lysis buffer, and sonicated. Soluble chromatin was collected by centrifugation, precleared with protein G-agarose,.. (Rocky Hill, NJ) were used at 1,000 U/mL and 10 ng/mL, respectively. 4-Hydroxytamoxifen was from Sigma-Aldrich (St. Louis, MO). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 5 fetal bovine serum. IKK–null cells were a gift from Dr. Michael Karin. IRF1-null MEFs and their wild-type counterparts were a gift from Dr. Tadatsugu Taniguchi.Quantitative real-time PCRTotal RNA was isolated from cells by using Trizol (Invitrogen, Carlsbad, CA). Two micrograms of RNA was treated in a 20 L reaction mixture containing two units of DNAse I (Invitrogen) for 15 min at 25 ; 2 L of 25 mM EDTA was added and the reaction was placed at 65 for 10 min. cDNA was synthesized from 8 L of the DNAse-treated RNA reaction mixture (0.75 g) by using the random priming procedure with the SuperScript II First Strand Synthesis Kit (Invitrogen). The final cDNA reaction mixture (20 L) was diluted 10-fold and 5 L was used as a template for PCR. Primer sequences were developed using the PerlPrimer program. The forward primer, gagagtcaggagaaagggcga, anneals within the first intron of ip-10. The reverse primer, gcaacttgtcagttacgaaatcct, anneals within the first exon. Amplicons were designed to be 100 to 200 base pairs long and to overlap a splice site. Primers were then tested in serial dilutions of cDNA to assure 90 ?00 efficiency. Real-time PCR was performed by using 500 nM of primers, 5 L of diluted cDNA sample, and 10 L of iQ SYBER Green Supermix (BioRad, Hercules, CA). jir.2012.0140 All samples were amplified in triplicate and normalized against gapdh. Amplification was performed by using a BioRad iCycler IQ real-time PCR instrument. Parameters for amplification were: 95 for 3 min, followed by 40 cycles at 95 for 30 s, 65 for 30 s, and 72 for 30 s. The initial amplicon for each primer was assayed by melt curve analysis and agarose gel electrophoresis and all subsequent amplifications with that primer set were assayed by melt curve analysis after 40 cycles.Retroviral transductionBosc packaging cells were transfected with pBabeHygroIKK- using Lipofectamine Plus (Invitrogen, Carlsbad, CA). Virus-containing supernatant medium, collected 24 and 48 h later, was passed through a 0.2 M filter and combined with 5 g/mL of polybrene. Equal parts of filtered virus and fresh medium were then used to infect cells. Twenty-four hours after the final round of virus treatment, IKK–null cells were seeded at 20 confluence and grown in journal.pone.0158910 antibioticcontaining medium for selection.Western analysisAfter treatment, cells at 90 confluence in 100-mm dishes were washed twice with phosphate-buffered saline (PBS), scraped into Eppendorf tubes, and lysed for 10 min in a buffer containing 1 Triton X-100, 50 mM Tris HCl, pH 8, 150 mM NaCl, 10 mM sodium fluoride, 5 mM sodium pyrophosphate, 10 mM orthovanadate, 1 mM leupeptin, 10 mM aprotonin, and 1 mM phenylmethanesulfonyl fluoride. Cellular debris was removed by centrifugation at 16,000g for 10 min. Cell extracts were fractionated by electrophoresis in 10 SDS-PAGE gels and transferred to PVDF membranes. Anti-mouse IRF1 (M-20), p65, and anti-histone antibodies were from Santa-Cruz (Santa Cruz, CA).Chromatin immunoprecipitation (ChiP) assaysThese assays were performed as described (Sakamoto and others 2004). In brief, MEFs were untreated or treated as described, fixed in 1 formaldehyde, resuspended in SDS-containing lysis buffer, and sonicated. Soluble chromatin was collected by centrifugation, precleared with protein G-agarose,.. (Rocky Hill, NJ) were used at 1,000 U/mL and 10 ng/mL, respectively. 4-Hydroxytamoxifen was from Sigma-Aldrich (St. Louis, MO). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 5 fetal bovine serum. IKK–null cells were a gift from Dr. Michael Karin. IRF1-null MEFs and their wild-type counterparts were a gift from Dr. Tadatsugu Taniguchi.Quantitative real-time PCRTotal RNA was isolated from cells by using Trizol (Invitrogen, Carlsbad, CA). Two micrograms of RNA was treated in a 20 L reaction mixture containing two units of DNAse I (Invitrogen) for 15 min at 25 ; 2 L of 25 mM EDTA was added and the reaction was placed at 65 for 10 min. cDNA was synthesized from 8 L of the DNAse-treated RNA reaction mixture (0.75 g) by using the random priming procedure with the SuperScript II First Strand Synthesis Kit (Invitrogen). The final cDNA reaction mixture (20 L) was diluted 10-fold and 5 L was used as a template for PCR. Primer sequences were developed using the PerlPrimer program. The forward primer, gagagtcaggagaaagggcga, anneals within the first intron of ip-10. The reverse primer, gcaacttgtcagttacgaaatcct, anneals within the first exon. Amplicons were designed to be 100 to 200 base pairs long and to overlap a splice site. Primers were then tested in serial dilutions of cDNA to assure 90 ?00 efficiency. Real-time PCR was performed by using 500 nM of primers, 5 L of diluted cDNA sample, and 10 L of iQ SYBER Green Supermix (BioRad, Hercules, CA). jir.2012.0140 All samples were amplified in triplicate and normalized against gapdh. Amplification was performed by using a BioRad iCycler IQ real-time PCR instrument. Parameters for amplification were: 95 for 3 min, followed by 40 cycles at 95 for 30 s, 65 for 30 s, and 72 for 30 s. The initial amplicon for each primer was assayed by melt curve analysis and agarose gel electrophoresis and all subsequent amplifications with that primer set were assayed by melt curve analysis after 40 cycles.Retroviral transductionBosc packaging cells were transfected with pBabeHygroIKK- using Lipofectamine Plus (Invitrogen, Carlsbad, CA). Virus-containing supernatant medium, collected 24 and 48 h later, was passed through a 0.2 M filter and combined with 5 g/mL of polybrene. Equal parts of filtered virus and fresh medium were then used to infect cells. Twenty-four hours after the final round of virus treatment, IKK–null cells were seeded at 20 confluence and grown in journal.pone.0158910 antibioticcontaining medium for selection.Western analysisAfter treatment, cells at 90 confluence in 100-mm dishes were washed twice with phosphate-buffered saline (PBS), scraped into Eppendorf tubes, and lysed for 10 min in a buffer containing 1 Triton X-100, 50 mM Tris HCl, pH 8, 150 mM NaCl, 10 mM sodium fluoride, 5 mM sodium pyrophosphate, 10 mM orthovanadate, 1 mM leupeptin, 10 mM aprotonin, and 1 mM phenylmethanesulfonyl fluoride. Cellular debris was removed by centrifugation at 16,000g for 10 min. Cell extracts were fractionated by electrophoresis in 10 SDS-PAGE gels and transferred to PVDF membranes. Anti-mouse IRF1 (M-20), p65, and anti-histone antibodies were from Santa-Cruz (Santa Cruz, CA).Chromatin immunoprecipitation (ChiP) assaysThese assays were performed as described (Sakamoto and others 2004). In brief, MEFs were untreated or treated as described, fixed in 1 formaldehyde, resuspended in SDS-containing lysis buffer, and sonicated. Soluble chromatin was collected by centrifugation, precleared with protein G-agarose,.. (Rocky Hill, NJ) were used at 1,000 U/mL and 10 ng/mL, respectively. 4-Hydroxytamoxifen was from Sigma-Aldrich (St. Louis, MO). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 5 fetal bovine serum. IKK–null cells were a gift from Dr. Michael Karin. IRF1-null MEFs and their wild-type counterparts were a gift from Dr. Tadatsugu Taniguchi.Quantitative real-time PCRTotal RNA was isolated from cells by using Trizol (Invitrogen, Carlsbad, CA). Two micrograms of RNA was treated in a 20 L reaction mixture containing two units of DNAse I (Invitrogen) for 15 min at 25 ; 2 L of 25 mM EDTA was added and the reaction was placed at 65 for 10 min. cDNA was synthesized from 8 L of the DNAse-treated RNA reaction mixture (0.75 g) by using the random priming procedure with the SuperScript II First Strand Synthesis Kit (Invitrogen). The final cDNA reaction mixture (20 L) was diluted 10-fold and 5 L was used as a template for PCR. Primer sequences were developed using the PerlPrimer program. The forward primer, gagagtcaggagaaagggcga, anneals within the first intron of ip-10. The reverse primer, gcaacttgtcagttacgaaatcct, anneals within the first exon. Amplicons were designed to be 100 to 200 base pairs long and to overlap a splice site. Primers were then tested in serial dilutions of cDNA to assure 90 ?00 efficiency. Real-time PCR was performed by using 500 nM of primers, 5 L of diluted cDNA sample, and 10 L of iQ SYBER Green Supermix (BioRad, Hercules, CA). jir.2012.0140 All samples were amplified in triplicate and normalized against gapdh. Amplification was performed by using a BioRad iCycler IQ real-time PCR instrument. Parameters for amplification were: 95 for 3 min, followed by 40 cycles at 95 for 30 s, 65 for 30 s, and 72 for 30 s. The initial amplicon for each primer was assayed by melt curve analysis and agarose gel electrophoresis and all subsequent amplifications with that primer set were assayed by melt curve analysis after 40 cycles.Retroviral transductionBosc packaging cells were transfected with pBabeHygroIKK- using Lipofectamine Plus (Invitrogen, Carlsbad, CA). Virus-containing supernatant medium, collected 24 and 48 h later, was passed through a 0.2 M filter and combined with 5 g/mL of polybrene. Equal parts of filtered virus and fresh medium were then used to infect cells. Twenty-four hours after the final round of virus treatment, IKK–null cells were seeded at 20 confluence and grown in journal.pone.0158910 antibioticcontaining medium for selection.Western analysisAfter treatment, cells at 90 confluence in 100-mm dishes were washed twice with phosphate-buffered saline (PBS), scraped into Eppendorf tubes, and lysed for 10 min in a buffer containing 1 Triton X-100, 50 mM Tris HCl, pH 8, 150 mM NaCl, 10 mM sodium fluoride, 5 mM sodium pyrophosphate, 10 mM orthovanadate, 1 mM leupeptin, 10 mM aprotonin, and 1 mM phenylmethanesulfonyl fluoride. Cellular debris was removed by centrifugation at 16,000g for 10 min. Cell extracts were fractionated by electrophoresis in 10 SDS-PAGE gels and transferred to PVDF membranes. Anti-mouse IRF1 (M-20), p65, and anti-histone antibodies were from Santa-Cruz (Santa Cruz, CA).Chromatin immunoprecipitation (ChiP) assaysThese assays were performed as described (Sakamoto and others 2004). In brief, MEFs were untreated or treated as described, fixed in 1 formaldehyde, resuspended in SDS-containing lysis buffer, and sonicated. Soluble chromatin was collected by centrifugation, precleared with protein G-agarose,.