L mitochondrial regulation.Table 1 Demographic and metabolic characteristics of participantsCharacteristics Sex (male/female) Age (years) BMI (kg/m2) Fasting glucose (mg/dL) Fasting insulin (U/mL) HOMA-IR Triglyceride (mg/dL) HDL (mg/dL) LDL (mg/dL) VLDL (mg/dL) LDL/HDL ratio Total Cynaroside web cholesterol (mg/dL) Total cholesterol/HDL HbA1c ( ) Lean (n = 8) 2/6 28.1 ?4.5 23.1 ?0.6 83.9 ?1.9 9.4 ?1.6 1.94 ?0.32 94.9 ?16.6 59.8 ?4.1 94.4 ?8.3 19.0 ?3.3 1.7 ?0.2 173.2 ?7.5 3.0 ?0.3 5.4 ?0.1 Obese (n = 32) 8/24 49.5 ?2.4** 36.6 ?1.2*** 95.9 ?2.4* 21.8 ?2.5* 5.31 ?0.68* 145.8 ?20.5 53.8 ?2.1 115.6 ?4.8* 29.2 ?4.1 2.2 ?0.1* 195.2 ?6.2 3.8 ?0.2* 5.7 ?0.Mean ?SE; *p < 0.05; **p < 0.001; ***p < 0.Moreover, the plasma LDL level (115.6 ?4.8 vs. 94.4 ?8.3, p < 0.05), low-density lipoprotein (LDL)/high-density lipoprotein (HDL) ratio (2.2 ?0.1 vs. 1.7 ?0.2, p < 0.05), and total cholesterol/HDL ratio (3.8 ?0.2 vs. 3.0 ?0.3, p < 0.05) all showed significant elevation. These findings suggest that the obese group had impairment in insulin signaling, concurrent with aberrant glucose and lipid metabolism.mtDNAn was reduced in obese subjectsResultsMetabolic changes in obese subjectsAmong the 40 participants, 32 people had a BMI greater than 30 (mean value = 36.6; referred to later as obese group) and 8 showed BMI below 25 (mean value = 23.1; referred to later as lean group), with the difference between the two groups being significant (p < 0.0001). As shown in Table 1 and Additional file 1: Figure S1, the obese group showed a significant impairment in fasting glucose (95.9 ?2.4 vs. 83.9 ?1.9 in the lean group, p < 0.05), and fasting insulin levels dramatically increased (21.8 ?2.5 vs. 9.4 ?1.6 in the lean group, p < 0.05), suggestive of impaired insulin sensitivity or development of insulin resistance [37, 38]. Insulin resistance was further confirmed by the HOMA-IR value, which was 2.7-fold (p < 0.05) higher in the obese group than in the lean one.The mitochondrial genome or mtDNA encodes 13 protein components of the respiration chain that underpin mitochondrial function [39, 40]. We found that the mtDNAn in the obese group was 6.9-fold lower (delta log-mtDNAn = 0.84, p < 0.001) when compared with their lean counterparts (Fig. 1). Given the significant age difference shown in Table 1 and Additional file 1: Figure S1, we conducted an age-matched analysis of mtDNAn, which indicated an mtDNAn tenfold lower (delta log-mtDNAn = 0.99, p < 0.05) in obese the group than in the lean group (Additional file 2: Figure S2). This is consistent with a previous report showing lower mitochondrial content in the skeletal muscle and adipose tissues from obese individuals [7?, 11]. Because changes in mtDNAn can affect the integrity, assembly, and operation of the mitochondrial respiratory chain [41, 42], it is conceivable that the mitochondrial function or capacity is impaired in obese subjects.Alteration of mtDNAn was associated with insulin resistanceTo examine how mtDNAn alteration was associated with the metabolic changes in obese subjects, we compared the mtDNAn in the insulin-sensitive (InS) groupZheng et al. Clinical Epigenetics (2015) 7:Page 3 ofless than 125 mg/DL indicates impaired fasting glucose (IFG) [46]. In the IFG group, the fasting glucose level was 111 mg/dL on average, significantly higher than that of the NFG group (86 mg/dL on average, p < 0.0001). However, the mtDNAn values of these two groups showed no significant PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27864321 difference (Fig. 3). In addition, mtDNAn did not c.

Their corresponding negative controls was 50 nmol/l. Twenty-four hours later, cells were harvested to evaluate the transfection efficiency. Then, successfully transfected cells were used for the following experiments. For miR-138 inhibitor, the single-stranded RNA sequence was 5-CGGCCUGAUUCACAACACCAGCU-3. 5- CAGUACUUUUGUGUAGUACAA-3 was the sequence of its corresponding negative control. For miR-138 mimics, the sequences of oligonucleotides were 5-AGCU GGUGUUGUGAAUCAGGCCG-3 (sense), and 5-GCC UGAUUCACAACACCAGCUUU-3(antisense). And the sequences were 5-UUCUCCGAACGUGUCACGUT T -3(sense) and 5- ACGUGACACGUUCGGAGAA TT-3 (antisense) for its negative control.qPCRto the manufacturer’s protocol. The reverse transcription primer for miR-138 was 5-GTCGTATCCAGTGCA GGGTCCGAGGTATTCGCACTGGATACGACCGGC CT-3, and primer for small nuclear RNA U6 was 5- GTCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGATACGACAAAATA-3. The mature miR138 level was normalized with U6 determined by qPCR, as described previously. Primers sequences were as follows: miR-138 forward: PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28549975 5-AAGCGGAGCTGGTGTTGTGAATC-3, reverse: 5- ATCCAGTGCAGGGTCCGAG G-3; U6 forward: 5-AGAGAAGATTAG CATGGCCC CTG-3, reverse: 5-ATCCAGTGCAGGGTCCGAGG-3.WB analysisWB analysis was performed as described previously [11]. Briefly, cell protein was extracted using Mammalian Protein Extraction Reagent (Thermo Scientific, Pittsburgh, PA, USA) supplemented with 1 protease inhibitor cocktails (Sigma-Aldrich, Hamburg, Germany). Protein concentration was measured using a BCA protein assay kit (Thermo Scientific). The protein samples (10?0 g) were separated by 12 SDS-PAGE, transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA) and then detected with appropriate primary and secondary antibodies. Protein bands were visualized by chemiluminescence (Thermo Scientific) and scanned via a Kodak Image Station (Carestream Health, Inc., Rochester, New York, USA). The primary antibodies used were goat antiANGPTL1 polyclonal antibody (1:1000, R D Systems, Minneapolis, MN, USA) and rabbit anti-GAPDH monoclonal antibody (1:1000, Cell Signaling Technology, Beverly, MA, USA).Transwell migration and invasion assayTotal RNA from cells and fresh human tissues was isolated using RNAiso reagent (Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions. The SIS3 site quality and quantity of RNA were evaluated using NanoDrop 1000 spectrophotometer (Thermo Scientific, Pittsburgh, PA, USA). cDNA was synthesized with PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara Biotechnology). To validate the mRNA expression profiles, qPCR was performed using a standard SYBR-Green PCR kit protocol (Takara Biotechnology) with the StepOne Plus Real Time PCR System (Life Technologies). The primers were synthesized by Sangon Biotech (Shanghai, China), and the sequences were as follows: ANGPTL1 forward: 5-CAACATATTCCTAACAGCC AACAG -3, reverse: 5-TGACAGTCTTTGAATGGT CCTTC -3; GAPDH forward: 5- TCTCTGCTCCTC CTGTTCGA -3, reverse: 5- GCGCCCAATACGACC AAATC -3. All PCR reactions were performed in triplicate. GAPDH was used as an internal control. For quantifying mature miR-138, reverse transcription was performed using a miRNA 1st Strand cDNA Synthesis kit (Sangon Biotech, Shanghai, China) accordingCells resuspended in 200 l serum-free medium were seeded in the upper chamber with 10 serumcontaining medium in the lower chamber of 24-well transwell plates (Corning Inc., NY, USA). After 48 or 72 h, the non-invaded cells in the upper chamber were removed wi.

Rther reduce Evans blue leakage in gp91phox KO mice. *p < 0.05 versus NA WT group, n = 7.Transmembrane protein occludin and claudins are the key molecules forming the seal between adjacent endothelial cells of the BBB. Using gp91 phox knockout mice, we tested the effect of gp91phox containing NADPH oxidase on tight junction protein occludin and claudin-5. Consistent with our results obtained from ischemic stroke rats [4], ischemia and reperfusion induced a reduction in occludin protein, but not claudin-5, in wildtype mice, and NBO treatment significantly reversed this reduction (Figure 5). Considering the fact that occludin is substrate of MMP-9 and reduced MMP-9 6-Methoxybaicalein clinical trials induction in the ischemic brain of gp91phox knockout mice (Figure 4), we speculated that gp91 phox knockout could lead to a reduction in occludin loss in ischemic brain tissue. Indeed, 90-min MCAO with 22.5 hrs of reperfusion induced occludin degradation to much less degree in gp91phox knockout mice than normoxic PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26240184 wild-type mice (Figure 5). Similar to their effect on MMP-9 induction (Figure 4), the combination of NBO and gp91phox knockout led to a further, but not significant, reduction in occludin protein loss in the ischemic tissue compared to each manipulation alone (Figure 5). No significant effects were observed for NBO or gp91phox knockout on claudin-5 protein. These results suggest that gp91phox containing NADPH oxidase is implicated in occludin degradation in the ischemic brain.Discussion Using gp91phox knockout mice, the present study unambiguously demonstrates that Nox2-containing NADPHLiu et al. Medical Gas Research 2011, 1:22 http://www.medicalgasresearch.com/content/1/1/Page 5 ofFigure 4 NBO treatment or gp91phox knock-out significantly reduces MMP-9 induction in ischemic brain tissue after 90-min MCAO with 22.5 hrs of reperfusion. A) Hemispheric brain tissue was homogenized for analyzing MMP-2 and 9 levels with gel gelatin zymography. Upper panel: representative gelatin zymograms showing the expression of proforms of MMP-2 and 9 in Nonischemic (Non-I) and ischemic (I) brain tissues in normoxic wild-type (NA-WT), NBO-treated WT (NBO-WT), normoxic gp91phox knock-out (NA-KO) and NBO-KO mice. STD is a mixture of human standard MMP-2 and 9. Bottom panels: the band intensities of MMP-2 and 9 were quantified. MMP-9 was significantly induced in the ischemic brain of NA-WT mice, and this induction was significantly inhibited by NBO or gp91phox KO. The combination of NBO and gp91phox KO led to a further, but not significant, reduction in MMP-9 compared each modulation alone (Left bottom panel). No significant changes were observed in MMP-2 for all groups (Right bottom panel). *p < 0.05 versus Non-I, n = 6; #p < 0.05 versus NA-WT, n = 6. B) Hemispheric brain tissue was homogenized for analyzing MMP-9 protein level with western blot. Upper panel: representative blots of MMP-9 protein in hemispheric brain tissue obtained from NA-WT, NBO-WT, NA-KO and NBO-KO mice. b-actin served as a protein loading control. Bottom panel: the relative quantity of MMP-9 protein was calculated after normalization to b-actin. *p < 0.05 versus Non-I, n = 6; #p < 0.05 versus NA-WT, n = 6.Liu et al. Medical Gas Research 2011, 1:22 http://www.medicalgasresearch.com/content/1/1/Page 6 ofFigure 5 NBO treatment or gp91 phox knock-out significantly reduces occludin degradation in ischemic brain tissue after 90min MCAO with 22.5 hrs of reperfusion. Hemispheric brain tissue was homogenized for analyzing tigh.

Ed with these properties. MHCI was detected mainly in the cytoplasm, and the expression was increased by IL-17 in a dose-dependent manner. Compared with MHCI, MHCII revealed a fainter basic expression and also an increase in protein expression after IL-17, with a significantly increased expression at 0.5 ng/mL IL-17, whereas 50 ng/mL just revealed a tendency without statistical significance. Antigenic peptides are transferred to the endoplasmic reticulum PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28151467 by TAP. We found that the expression of TAPII increased slightly in a dose-dependent manner following IL-17 treatment, but without statistical significance in densitometric analysis. Thus, we assume that the capacity of SCs to HIV-1 integrase inhibitor 2 web activate CD8+ and CD4+ T cells, and therefore to act as antigenpresenting cells in a condition of inflammation, was increased. In accord with our findings, SCs express major histocompatibility complex molecules and increase the expression of these molecules under pro-inflammatory conditions in vivo and in vitro [17,18,58-70]. Whether the change of MHCII and TAP expression in SC after IL-17 stimulation is functional is notional. The results warrant further functional analysis of MHCII expression in SCs. Corroborating our results, regulated expression of the intracellular antigen-processing machinery in peripheral nerve sections from GBS patients was recently shown (Meyer zu Horste et al. [17]), and SCs most likely act as non-professional antigen-presenting cells under certain conditions. The IL-17-induced increased expression can be interpreted as an immunological alignment of SCs. This modulation of SC homeostasis by inflammatory mediators was reported for interleukins, iNOS, COX-2, and MMPs as a response to the surrounding environment [20-24]. IL-17 led to no reduction of SC viability, showed no effect on NF expression, and did not change the structural myelin formation, but significantly interfered with SC-mediated myelination. Negative regulators of myelination which do not necessarily initiate apoptosis such as c-Jun, Notch, Sox-2, Pax-3, Id2, Krox-24, and Egr-3 are known. They are found downregulated after initiation of myelination and may be reactivated after PNS injury causing SC dedifferentiation [41]. Further inflammatory mediators, such as TNF-, can promote phenotype reversion of mature to immature SCs [25-27,41]. It was suggested before that negative regulators of SCmyelination may foster neuronal survival and axonal regrowth but actively suppress myelination. In the context of neuropathies, such pathways may cause further harm [41].does not appear to involve an indirect effect caused by either a reduced neuronal stimulus for myelination or a toxic effect, but rather a direct reprogramming of SC differentiation. This latter effect may contribute to Wallerian degeneration and equipping of the inflammatory facilities of SCs in order to modulate the process of inflammation. These data provide new insights into the role of IL-17 in the inflammatory response in the PNS that could be useful in the development of targeted therapies.Abbreviations AU: arbitrary unit; AX: axon; CIDP: chronic inflammatory demyelinating polyneuropathy; CSF: cerebrospinal fluid; DAPI: diamidino-2-phenylindole; DMEM: Dulbecco’s modified eagle’s medium; DRG: dorsal root ganglia; FCS: fetal calf serum; FKS: forskolin; GAPDP: glyceraldehyde 3-phosphate dehydrogenase; GBS: Guillain-Barr?syndrome; Glut: L-glutamine; HBSS: Hank’s balanced salt solution; HEPES: 4-(2-hydroxyethyl)-1-piperazi.

Central.com/1472-6882/14/Page 9 of36. Khan MR, Rizvi W, Khan GN, Khan RA, Shaheen S: Carbon tetrachloride induced nephrotoxicity in rat: Protective role PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/27597769 of Digera muricata (L.) Mart. J Ethnopharmacol 2009, 122:91?9. 37. Zakaria I, Khalik IAE, Selim ME: The protective effects of curcumin against carbon tetrachloride induced pulmonary injury in rats. Egypt J Med Lab Sci 2004, 13:1?5. 38. Khan RA, Khan MR, Sahreen S: Protective effect of Sonchus asper extracts against experimentally-induced lung injuries in rats: A novel study. Exp Toxicol Pathol. doi:10.1016/j.etp.2011.01.007.doi:10.1186/1472-6882-14-40 Cite this article as: Sahreen et al.: Effects of Carissa opaca fruits extracts on oxidative pulmonary damages and fibrosis in rats. BMC Complementary and Alternative Medicine 2014 14:40.Submit your next manuscript to BioMed Central and take full advantage of:?Convenient online submission ?Thorough peer review ?No space constraints or color figure charges ?Immediate publication on acceptance ?Inclusion in PubMed, CAS, Scopus and Google Scholar ?Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submit
Shewamene and Engidawork BMC Complementary and Alternative Medicine 2014, 14:66 http://www.biomedcentral.com/1472-6882/14/RESEARCH ARTICLEOpen AccessSubacute administration of crude khat (Catha edulis F.) extract induces mild to moderate nephrotoxicity in ratsZewdneh Shewamene and Ephrem Engidawork*AbstractBackground: Although various studies have been conducted to shed light on the pharmacological actions of khat, little or no data are available regarding khat’s effect on the renal redox system. The aim of this study was therefore to investigate the Thonzonium (bromide) price potential of nephrotoxicity associated with khat exposure in rats. Methods: Sprague Dawely rats were randomly assigned into eight experimental groups. Animals were treated with Tween80, gentamicin 100 mg/kg and khat at various doses (100, 200 and 400 mg/kg) alone or in combination with gentamicin for ten days. The animals were then sacrificed to obtain blood and renal tissues for subsequent analysis. Renal markers, including creatinine, blood urea nitrogen, antioxidant enzymes as well as markers for lipid peroxidation were determined using established protocols. In addition, histopathological changes were evaluated with hematoxilin and-eosin staining technique. Results: Lower and moderate doses of khat did not alter the measured parameters compared to controls. By contrast, higher dose (400 mg/kg) of khat not only increased levels of serum creatinine and blood urea nitrogen (p < 0.001) but also levels of malondialdehyde (p < 0.01). Moreover, 400 mg/kg of khat significantly decreased enzymatic activities of superoxide dismutase (p < 0.01) and catalase (p < 0.001). When khat was administered with gentamicin, it was again the higher dose that significantly accentuated gentamicin-induced alterations in the renal system. Conclusions: Khat treatment at high dose is demonstrated to induce mild to moderate renal damage. Moreover, it creates synergy when combined with nephrotoxic drugs such as gentamicin. Keywords: Nephrotoxicity, Superoxide dismutase, Catalase, Malondialdehyde, Khat, RatBackground Khat (Catha edulis Forsk) is a shrub or small to mediumsized evergreen tree that belongs to the Celastraceae family. It is cultivated mainly in Yemen and East African Countries [1]. The shrub grows to a height of 6 meters and the leaves are leathery, glossy, brown.

Rlapped by PU.1 ChIP-seq peaks. g Relationship between total PU.1 ChIP signal found in vehicle controls and SAHA-treated K562 at all PU.1 peaks. ChIP-seq signal is normalized by total number of mapped reads in each condition (Spearman’s correlation = 0.811)local deposition of the histone enhancer mark H3K4me1 [16]. We detected H3K4me1 enrichment at each of the six sites prior to HDACi SCR7 cost treatment (Additional file 6: Fig. S3C) that modestly decreased at five of the six sites following treatment (Fig. 3d), possibly reflecting nucleosome repositioning. To characterize genome-wide PU.1-binding changes with HDACi treatment, ChIP-seq was performed on vehicle and SAHA-treated K562 cells in triplicate, which identified 31977 PU.1-binding sites in total. We observed hundreds of sites with increased PU.1 binding following HDACi treatment similar to those flanking the CDKN1A gene (p21) (Fig. 3e), a well-studied tumor suppressor that mediates p53-dependent G1 growth arrest and becomes up-regulated following HDACi treatment [20]. As predicted, PU.1 binding was highly enriched in opened DHS sites relative to all DHS sites in K562 cells or closed DHS sites (Fig. 3f). Interestingly, PU.1 ChIP-seq signal increased globally at the vast majority of peaks following SAHA treatment (Fig. 3g) while maintaining a similar distribution of total binding sites. This result was detected in each of the three replicates processed as pairs of HDACi-treated and vehicle control cells. The global increase in PU.1 binding also matches our ChIP-qPCR results (Fig. 3b, c).PU.1 overexpression modestly increases accessibilityIn addition to our ChIP-seq showing global increases in PU.1 occupancy following SAHA treatment, we also detected that PU.1 expression levels increase during HDACi exposure in our RNA-seq data (Additional file 7: Fig. S4A). PU.1 transcription is known to be tightly regulated during normal hematopoietic differentiation with different expression levels facilitating key transition points in cell lineage [21, 22]. To test whether HDACi-induced up-regulation of PU.1 was responsible for the chromatin accessibility changes, we transfected K562 cells with either a PU.1 cDNA under control of a viral promoter or an empty vector control. We selected for transformed cells by G418 resistance and performed DNase-seq. On the day of cell harvest, we confirmed PU.1 overexpression by qPCR (Additional file 7: Fig. S4B) and western blot (Fig. 4a).To characterize the impact of overexpression of PU.1 on chromatin accessibility, we analyzed PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26024392 the original set of 7962 SAHA-opened DHS sites and divided them by those bound by PU.1 (n = 2137) versus the remaining that did not bind PU.1 (n = 5825). For the 2137 sites bound by PU.1, we observed a reproducible increase in mean accessibility in cells that overexpress PU.1 (Fig. 4b). This increase in accessibility was not detected at the 5825 SAHA-opened DHS sites that do not bind PU.1 (Fig. 4b). Furthermore, the distribution of fold-changes in accessibility found at SAHA-opened DHS sites with PU.1 binding was significantly greater than that of the SAHAopened DHS sites without PU.1 binding (Mann hitney test, P < 2.9 ?10-59) or PU.1-bound DHS sites that did not open further with SAHA treatment (P < 6.7 ?10-39) (Fig. 4c). These patterns are exemplified by two DHS sites found in the same intron of the TMEM51 gene; both sites open with SAHA treatment, but only the site with PU.1 bound displays increased hypersensitivity following PU.1 overex.

Nces Brigelius et al. (2012) Yu et al. (2007) Gomez et al. (1997) Shao et al. (2012) Baker et al. (1998) Chen et al. (2011) Yamazaki et al. (2011)CDRSL FSL41 (14/34)DDRFSL74 (25/34)Valencia et al. (2012) Ruiz et al. (2011) Kim et al. (2011) Dactinomycin biological activity Sanz-Pamplona et al. (2011) Eletto et al. (2010) Calderwood et al. (2007) Rausa et al. (2004) Wolfrum et al. (2004) Tang et al. (2011) Schmedt et al. (2012) Zong et al. (2011) Arenzana et al. (1995) Fraczek et al. (2010) Haakensen et al. (2011) Tomita et al. (2009) Qiao et al. (2009) Zidane et al. (2012)HSP90BFSL82 (28/34)FOXAFSL29 (10/34)SDC1 C4BPA SCGB3A1 RPSAFSL FSL FSL FSL82 (28/34) 35 (12/34) 56 (19/34) 65 (22/34)ERGICFSL76 (47/62)Zhang et al. (2012) Nishikawa et al. (2007) Otte et al. (2002) Liu et al. (2011) Aida et al. (2011) Lee et al. (2010) Ma et PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28607003 al. (2007) Moon et al. (2010) Selmi et al.(2012) Lee et al. (2012) Matsui et al. (2012) Nakanishi et al. (2006) Soupene et al. (2012) Mansilla et al. (2009)DDX58 CCNDBP1 TMSB4X CXCL17 LPCATFSL FSL FSL FSL FSL47 (29/62) 47 (29/62) 37 (23/62) 45 (28/62) 47 (29/62): Down-regulation of the genes in lung cancer tissues compared with their adjacent nonmalignant lung tissues; : Up-regulation of the genes in lung cancer tissues compared with their adjacent nonmalignant lung tissues; #: Number of cases applicable/total number of cases examined.Wu et al. BMC Cancer 2013, 13:44 http://www.biomedcentral.com/1471-2407/13/Page 6 ofExpression of ERGIC3 protein in cultured cells and in lung cancer tissues by western blotExpression of the ERGIC3 protein was analyzed using western blot. Expression of ERGIC3 was increased in 67 (10/15) of the tumor cases (Figure 1A). Similarly, expression of ERGIC3 protein was increased in all three lung cancer cell lines by comparison with the BEAS-2B (Figure 1B).Subcellular localization of ERGIC3 protein in cultured cellsIn cultured cells, the subcellular localization of ERGIC3 was examined by immunofluorescence double-staining using markers of the Golgi apparatus and endoplasmic reticulum (ER). ERGIC3 was mainly located at the Golgi apparatus and ER in the lung cancer cell lines. Interestingly, ERGIC3 was distributed at the side of nucleus in EPLC-32M1, 801D, and NCI-H446 cells, but uniformly present around nucleus in SPCA-1, GLC-82 and A549 cells (Figure 2). We also found that ERGIC3 was co-localized with the epithelia mucin MUC1 and -Galactoside 2,6 Sialyltransferase (ST), which were principally located at the ER and Golgi apparatus in the cultured cells (Figure 2).Expression and localization of the ERGIC3 protein in lung cancer tissues by immunohistochemical stainingERGIC3 was positive in 89 of (31/35) NSCLCs, and strongly stained in 63 (22/35). Interestingly, the positive rate of AC (100 , 22/22) was higher than that of SCC (69 , 9/13). In poorly differentiated NSCLCs, 36 (4/11) cases were not stained. We noticed that all of negative specimens were poorly differentiated tumor cells, and the staining was decreased to the largest extent and even disappeared in poorly differentiated NSCLCs, compared with well and moderately NSCLCs (P <0.05). No correlations were observed between expression of ERGIC3 and the gender as well as smoking histories of the patients and TNM stage (Table 2).Effects of ERGIC3 expression on the proliferation of the epithelial cellsExpression and localization of the ERGIC3 protein was further investigated by immunohistochemistry in 35 cases of NSCLC. ERGIC3 was diffusely distribut.

Ish green, with serrated edges, arranged in an alternate fashion on straight branches. The young shoots and leaves are parts that are chewed for their psychoactive properties [2]. In Ethiopia, a number of local brands are available, including Aweday, Beleche, Abo mismar, Gelemso and Wondo. It is claimed that the Aweday variety cultivated* Correspondence: [email protected] Department of Pharmacology and Clinical Pharmacy, School of Pharmacy, Addis Ababa University, P.O, Box 1176, Addis Ababa, Ethiopiain Harar highlands of Eastern Ethiopia is the most potent and expensive among the local brands, and hence chosen for export [3,4] as well as for purpose of the present study. Central nervous system stimulation such as euphoria and alertness induced by cathinone, the main active constituent derived from khat chewing, makes it popular among large segments of the society. In addition, factors like easy transportation from village to city khat markets and affordability are thought to play an important role in widening its social use in society. People also believe that khat helps to work more effectively, particularly with manual work, due to increased energy and alertness [5]. Consumption of crude khat extract or its alkaloid fraction preceding stress has been shown to produce oxidative?2014 Shewamene and Engidawork; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Chloroquine (diphosphate) supplement Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Shewamene and Engidawork BMC Complementary and Alternative Medicine 2014, 14:66 http://www.biomedcentral.com/1472-6882/14/Page 2 ofstress in rats by altering activities of serum antioxidant enzymes [6]. Nephrotoxic and hepatotoxic effects are also reported following khat administration to New Zealand white rabbits [7,8]. The generation of free radicals is seriously implicated in khat toxicity following the observation that oral exposure of rats to khat was associated with decreased serum free radicals metabolizing enzymes such as superoxide dismutase (SOD) and catalase [9]. In addition, khat treated rats displayed hepatic enlargement, abnormal findings in serum aspartate aminotransferase, and alkaline phosphatase in both sexes as well as alterations in serum albumin and creatinine in female rats [10]. In spite of the vast published data on the pharmacology and chemistry of khat, toxicological studies with laboratory animals as well as toxicity reports in humans, particularly on the renal system, are scanty. Moreover, the effect of khat-induced redox changes, at least, in the kidney, has not yet been explored. Thus, there is a need for conducting laboratory studies to generate a sufficient body of knowledge PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/25432023 in the area. This study therefore attempted to investigate whether exposure of rats to khat had a potential to cause nephrotoxicity via alteration of the renal redox system.(400 g per flask) wrapped with aluminum foil to avoid light induced decomposition. Chloroform (150 mL) and diethyl ether (450 mL) (1: 3 v/v) were added to cover the minced leaves. The resulting mixture was shaken under dark condition for 24 h using a rotary shaker (New Bru.

Ative control(IC50 = 820.89 ?21.62 nM VS 2424.56 ?56.83nM, P = 0.001), SKOV3 cells were transfected with miR-9 inhibitor or negative control (IC50 = 122.74 ?10.12 nM VS64.63 ?2.74 nM, P = 0.000), the cytotoxicity of paclitaxel on EOC cells were assessed by MTS assay. b. Western blot analysis of CCNG1 in ST30 cells transfected with miR-9 mimic or negative control. GAPDH was used as house-keeping gene. c. Dual luciferase reporter assay. 293 T cells were transfected with CCNG1 -wild type 3UTR vectors or mutant 3UTR vectors together with miR-9 mimic or its negative control. Luciferase activity was measured 48 h after FPS-ZM1MedChemExpress FPS-ZM1 cotransfection. A decrease of the luciferase activity was observed in miR-9 overexpressing cells compared with control (* P = 0.008). d. Modulating miR-9 expression changed paclitaxel sensitivity of A2780 and A2780R cells. A2780 cells were transfected with miR-9 inhibitor or negative control (IC50 = 95.644 ?12.03 nM VS 38.16 ?6.18 nM, P = 0.000), A2780R cells were transfected with miR-9 mimic or negative control(IC50 = 194.94 ?9.36 nM VS 774.03 ?49.19 nM, P = 0.002). e. Western blot analysis of CCNG1 in SKOV3 cells transfected with miR-9 inhibitor, negative control or inhibitor combined with CCNG1 siRNA. GAPDH was used as house-keeping gene. f. Modulating CCNG1 expression changed paclitaxel sensitivity of ovarian carcinoma. Knockdown of CCNG1 alone enhanced paclitaxel cytotoxcity to ST30 cells (IC50 = 1468.50 ?32.19 nM VS 2545.84 ?168.83 nM, P = 0.000), while deleption CCNG1 reversed the role of miR-9 inhibitor on the paclitaxel sensitivity of SKOV3 cells (IC50 = 65.35 ?13.47 nM VS 177.36 ?20.88 nM, P = 0.001). The experiments were repeated three timesmiR-9 could inhibit CCNG1 expression in ST30 cells, while down-regulated miR-9 enhanced CCNG1 expression in SKOV3 cells (Fig. 2b, e). Using dual luciferase reporter assay, we found that the relative luciferase activities were significantly reduced in cells transfected with CCNG1 WT- 3UTR/miR-9 mimic vectors compared with those transfected with CCNG1 WT-3UTR/miR-9 mimic control (Fig. 2c). Furthermore, Realtime RT-PCR suggested that mRNA expression of CCNG1 in ST30 cells was significantly higher than that in SKOV3 (2.14 fold), which was contrary to the miR-9 expression trends in SKOV3 and ST30 cells (Additional file 2: Figure S1C). These data validate that miR-9 can directly bind to 3 UTR of CCNG1 and CCNG1 is regulated by miR-9.Li et al. BMC Cancer (2015) 15:Page 6 ofCCNG1 depletion enhances the paclitaxel sensitivity of EOC cellsCCNG1 was initially identified as a p53-regulated transcript induced by DNA damage [15]. Although its precise role on cellular growth control is still controversial, CCNG1 has been regarded as an oncogene [16, 17]. CCNG1 gene copy number is an independent marker of postsurgical survival in EOC patients who have received chemotherapy with taxanes and platinum compounds [18]. Thus it suggests that CCNG1, the target of miR-9, probably modulates the paclitaxel-sensitivity of EOC. To validate this hypothesis, we knocked down CCNG1 in ST30 cells through transfecting CCNG1 siRNA. The roles of CCNG1 siRNAs were confirmed using realtime RT-PCR and Western blot, and the most effective siRNA was chosen (Additional file 2: Figure S1D, E). IC50 of paclitaxel in ST30 cells was significantly decreased after CCNG1 depletion (Fig. 2f ), which confirmed that knockdown of CCNG1 PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28549975 alone would enhance paclitaxel cytotoxicity to EOC cells. Furthermore, when miR-9 inhibitor was tr.

Ed in writing this manuscript. SA is immunology laboratory technician who has performed the serology tests, and assisted in writing the methodology. AC has contributed to study design, conduct of the study, interpretation of serology tests, and assisted in writing the manuscript. All authors read and approved the final manuscript. Acknowledgment Authors acknowledge the financial RG7800MedChemExpress RG7800 support of this study by King Abdulaziz City for Science and Technology (KACST), Grant number LPG-10-41. Author details 1 Department of Pediatrics at King Fahad Medical City, Riyadh, Saudi Arabia. 2 Department of Pediatrics at King Saud Medical City, Riyadh, Saudi Arabia. 3 Department of Radiology at King Saud Medical City, PO box 7855, Riyadh 11117, Kingdom of Saudi Arabia. 4Department of Immunology, Pathology, Clinical Laboratory Medicine at King Fahad Medical City, Riyadh, Saudi Arabia. 5Division of Pediatric Gastroenterology, Hepatology Nutrition, University of King Saud Bin Abdulaziz for Health Sciences, Children’s Hospital, King Fahad Medical City, Riyadh, Saudi Arabia. 6Division of Pediatric Endocrinology, Children’s Hospital, King Saud Medical City, PO box 7855, Riyadh 11117, Kingdom of Saudi Arabia. Received: 17 October 2013 Accepted: 5 PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28549975 March 2014 Published: 17 March 2014 References 1. Barker JM, Yu J, Yu L, Wang J, Miao D, Bao F, Hoffenberg E, Nelson JC, Gottlieb PA, Rewers M, Eisenbarth GS: Autoantibody “subspecificity” in type 1 diabetes. Diabetes Care 2005, 28:850?55. 2. Barker JM: Clinical review: type 1 diabetes associated autoimmunity: natural history, genetic association, and screening. J Clin Endocrinol Metab 2006, 9:1210?217. 3. Choudhri K, Vergani G, Vergani GM: Immunological cross-reactivity to multiple auto antigens in patients with liver kidney microsomal type1 autoimmune hepatitis. Hepatology 1998, 28:1177?181. 4. Maggiore G, Bernard O, Homberg JC, Hadchouel M, Alvarez F, Hadchouel P, Odi re M, Alagille D: Liver disease associated with anti-liver kidney microsome antibody in children. J Pediatr 1986, 108:399?04. 5. da Silva ME, Porta G, Goldberg AC, Bittencourt PL, Fukui RT, Correia MR, Miura IK, Pugliese RS, Baggio VL, Can do EL, Kalil J, Santos RF, Rochal DM, Wajchenberg BL, Ursich MJ, Rosenbloom AL: Diabetes mellitus-related autoantibodies in childhood autoimmune hepatitis. J Pediatr Endocrinol Metab 2002, 15:1574. 6. De Block CE, De Leeuw IH, Pelckmans PA, Michielsen PP, Bogers JJ, Van Marck EA, Van Gaal LF: Autoimmune hepatitis, autoimmune gastritis, and gastric carcinoid in a type 1 diabetic patient. J Diabetes Complications 2002, 14:116?20. 7. Oki K, Yamane K, Koide J, Mandai K, Nakanishi S, Fujikawa R, Kohno N: A case of polyglandular autoimmune syndrome type III complicated with autoimmune hepatitis. Endocr J 2006, 53:705?09. 8. Allen S, Huber J, Devendrac D: Prevalence of organ-specific autoantibodies in childhood- and adult-onset type 1 diabetes. Ann N Y Acad Sci 2008, 1150:260?62.9.10.11.12.13.14.15.16. 17.18. 19.20.Heras P, Mantzioros M, Mendrinos D, Heras V, Hatzopoulos A, Xourafas V, Kritikos K, Karagiannis S: Autoantibodies in type 1 diabetes. Diabetes Res Clin Pract 2010, 90:e40 42. Konus OL, Ozdemir A, Akkaya A, Erbas G, Celik H, Isik S: Normal liver, spleen and kidney dimensions in neonates, infants and children: evaluation with sonography. Am J Roentgenol 1998, 171:1693?698. De Block CEM, Van Gaal LF, De Leeuw IH: High prevalence of manifestations of gastric autoimmunity in parietal cell antibodies positive type 1 (I.