Ally derived from veins and not arteries.the embryo and underscores the importance of the regulated expression of Prox1 in vascular development.Results Double transgenic embryos suffer from edemaThe early development of the lymphatic vasculature depends on the regulated expression of Prox1 on the cardinal vein. During this event, lymphatic precursor cells bud off from the vein and migrate outward in a directional fashion to form the primordial lymph sac [10,11]. Prox1 ablation results in the dedifferentiation of lymphatic endothelial cells to a more vascular cell-like identity, suggesting that this transcription factor is required for lymphatic differentiation [11,19]. To further extend these observations, we have generated a transgenic model where one can ML240 ectopically express Prox1 specifically in blood endothelial cells in order to demonstrate that Prox1 leads to the genetic reprogramming of the vasculature (Figure 1A) [15]. Indeed, in vitro data demonstrates that the overexpression of Prox1 generates a shift in the gene signature of vascular endothelial cells to a lymphatic cell profile [13,14]. Upon Prox1 overexpression in blood endothelial cells, late stage embryos display significant edema and anemia at E14.5 (Figure 1B and C). Previous results have demonstrated a distended lymph sac and separation of the epidermis from the dermis typical of a defect in lymphatic function [15]. Clearly, the overexpresion of Prox1 in blood endothelial cells has a negative effect on the development ofDifferences in the reprogramming of veins and arteries in DT embryosNext, we investigated whether reprogramming via Prox1 can be reproduced in vivo. Consistent with Schacht et al., in E13.5 control embryos Podoplanin expression becomes downregulated on the jugular vein with Prox1 expression being absent [20]. In contrast, Prox1 and Podoplanin are expressed on the jugular vein of double transgenic (DT) embryos (Figure 2A and B, arrows, Figure S1), along with LYVE-1 (Figure 2C and D, arrows). These results suggest that the blood vasculature is indeed malleable and that the overexpression of Prox1 can alter the profile of vascular endothelial cells to a more lymphatic phenotype in vivo. The above data points to the plasticity of the blood vascular system to Prox1 reprogramming, however an interesting exception was observed. Later in development, arterial endothelial cells in DT embryos appear resistant to reprogramming. At E13.5, markers such as Podoplanin (Figure 3A and C, arrowhead) and LYVE-1 (Figure 3B and D, arrowhead) are absent on the arteries of DT embryos. Upon further investigation, it was found that the arterial vessels of E13.5 DT embryos did not ectopically express Prox1, in contrast to the jugular vein and lymph sacs (Figure 3E, arrowhead, Figure S5). Indeed, by E11.5 Prox1 expression appears to be suppressed on the dorsal aortas of DT embryos. Of note, ProxFigure 1. Overexpression of Prox1 in the blood vasculature results in edema and embryonic CASIN biological activity lethality at E14.5. Gross analysis of embryos at E14.5 from control and double transgenic (DT) embryos for tie1 tTA:tetOS prox1. (A) Bigenic transgene construction. The absence of doxycycline is molecularly permissive for transgene expression. In contrast, the presence of doxycycline suppresses transgene expression. (B) Control embryos display typical architecture for blood vasculature, however transgenic overexpression of Prox1 results in edema, anemia and lethality. Scale bar = 1 cm. doi:10.1371/jour.Ally derived from veins and not arteries.the embryo and underscores the importance of the regulated expression of Prox1 in vascular development.Results Double transgenic embryos suffer from edemaThe early development of the lymphatic vasculature depends on the regulated expression of Prox1 on the cardinal vein. During this event, lymphatic precursor cells bud off from the vein and migrate outward in a directional fashion to form the primordial lymph sac [10,11]. Prox1 ablation results in the dedifferentiation of lymphatic endothelial cells to a more vascular cell-like identity, suggesting that this transcription factor is required for lymphatic differentiation [11,19]. To further extend these observations, we have generated a transgenic model where one can ectopically express Prox1 specifically in blood endothelial cells in order to demonstrate that Prox1 leads to the genetic reprogramming of the vasculature (Figure 1A) [15]. Indeed, in vitro data demonstrates that the overexpression of Prox1 generates a shift in the gene signature of vascular endothelial cells to a lymphatic cell profile [13,14]. Upon Prox1 overexpression in blood endothelial cells, late stage embryos display significant edema and anemia at E14.5 (Figure 1B and C). Previous results have demonstrated a distended lymph sac and separation of the epidermis from the dermis typical of a defect in lymphatic function [15]. Clearly, the overexpresion of Prox1 in blood endothelial cells has a negative effect on the development ofDifferences in the reprogramming of veins and arteries in DT embryosNext, we investigated whether reprogramming via Prox1 can be reproduced in vivo. Consistent with Schacht et al., in E13.5 control embryos Podoplanin expression becomes downregulated on the jugular vein with Prox1 expression being absent [20]. In contrast, Prox1 and Podoplanin are expressed on the jugular vein of double transgenic (DT) embryos (Figure 2A and B, arrows, Figure S1), along with LYVE-1 (Figure 2C and D, arrows). These results suggest that the blood vasculature is indeed malleable and that the overexpression of Prox1 can alter the profile of vascular endothelial cells to a more lymphatic phenotype in vivo. The above data points to the plasticity of the blood vascular system to Prox1 reprogramming, however an interesting exception was observed. Later in development, arterial endothelial cells in DT embryos appear resistant to reprogramming. At E13.5, markers such as Podoplanin (Figure 3A and C, arrowhead) and LYVE-1 (Figure 3B and D, arrowhead) are absent on the arteries of DT embryos. Upon further investigation, it was found that the arterial vessels of E13.5 DT embryos did not ectopically express Prox1, in contrast to the jugular vein and lymph sacs (Figure 3E, arrowhead, Figure S5). Indeed, by E11.5 Prox1 expression appears to be suppressed on the dorsal aortas of DT embryos. Of note, ProxFigure 1. Overexpression of Prox1 in the blood vasculature results in edema and embryonic lethality at E14.5. Gross analysis of embryos at E14.5 from control and double transgenic (DT) embryos for tie1 tTA:tetOS prox1. (A) Bigenic transgene construction. The absence of doxycycline is molecularly permissive for transgene expression. In contrast, the presence of doxycycline suppresses transgene expression. (B) Control embryos display typical architecture for blood vasculature, however transgenic overexpression of Prox1 results in edema, anemia and lethality. Scale bar = 1 cm. doi:10.1371/jour.

Ith four or more cysteine residues from the Antimicrobial Peptides Database (APD) [35]. This set was manually curated, keeping only the sequences annotated at least with activities against bacteria, fungi or virus. In addition, incomplete sequences were removed. PS was composed of 385 sequences with size ranging from 16 to 90 amino acid residues. The negative data set (NS) was composed of a subset of Protein Data Bank (PDB), while in our previous work it was composed of random proteins predicted as transmembrane [20]. Initially, the protein sequencesFigure 1. Principal component analysis of sequence descriptors for cysteine-stabilized peptides. The components are indicated by arrows: as larger the arrow is, major is the component contribution to the set’s variance. (A) The disposition of the nine sequence descriptors in the peptide space; (B) the final ensemble of descriptors, the descriptors hydrophobic moment, index of b-sheet formation, rate between charged and hydrophobic residues and a-helix propensity were ruled out. doi:10.1371/Dimethylenastron journal.pone.0051444.gCS-AMPPred: The Cysteine-Stabilized AMPs PredictorFigure 2. Distribution of sequence descriptor values. The left box in each panel corresponds to the AMPs. All descriptors have statistical differences when compared to the non-antimicrobial data set, with a get CASIN critical value of 0.05. The observed p-values are as follows: charge (,2.2e-16), hydrophobicity (2.169e-06), flexibility (,2.2e-16), index of a-helix formation (,2.2e-16) and index of loop formation (2.908e-10). doi:10.1371/journal.pone.0051444.gsubsequently the descriptors with redundant behavior or with little influence on variance were removed. Therefore, 18297096 a two sided Wilcoxon-Mann-Whitney non-parametric test was applied forverifying the differences between the sequence descriptors in the PS and NS sets, with a critical value of 0.05. The statistical analyses were done through the R package for statistical computing (http://www.r-project.org).Support Vector Machine’s Training and ValidationThree SVM models were developed through SVM Light [41], using the linear, polynomial and radial kernels. The training was done using the training set. An overview of the model’s accuracy was estimated through a 5-fold cross validation, taking into account only the training data set. Therefore, the models were challenged against the blind data set, where the following parameters were measured: Sensitivity TP |100 TPzFN ??SpecificityTN |100 TNzFP??AccuracyFigure 3. ROC curves for the CS-AMPPred models against the blind data set (BS1). doi:10.1371/journal.pone.0051444.gTPzTN |100 TPzTNzFNzFP??CS-AMPPred: The Cysteine-Stabilized AMPs PredictorTable 1. Evaluation of CS-AMPPred models against the individual cysteine-stabilized AMP classes and also PDB sequences which were not used in the data sets.a-defensins1 93.33 97.78 97.78 b-defensins1 96.83 95.24 96.83 CSab defensins1 81.36 77.12 77.12 Cyclotides1 70.34 81.36 83.05 Undefined1 84.13 79.37 80.95 PDB# 80.65 82.55 81.Model Linear Polynomial Radial#Antimicrobial Peptide Classes, values computed through equation 1 (Sensitivity). Non Antimicrobial Peptides, values computed through equation 2 (Specificity), using the 1364 sequences from PDB which were not included in NS. doi:10.1371/journal.pone.0051444.tTP |100 PPV TPzFP??(TP|TN){(FP|FN) MCC pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi.Ith four or more cysteine residues from the Antimicrobial Peptides Database (APD) [35]. This set was manually curated, keeping only the sequences annotated at least with activities against bacteria, fungi or virus. In addition, incomplete sequences were removed. PS was composed of 385 sequences with size ranging from 16 to 90 amino acid residues. The negative data set (NS) was composed of a subset of Protein Data Bank (PDB), while in our previous work it was composed of random proteins predicted as transmembrane [20]. Initially, the protein sequencesFigure 1. Principal component analysis of sequence descriptors for cysteine-stabilized peptides. The components are indicated by arrows: as larger the arrow is, major is the component contribution to the set’s variance. (A) The disposition of the nine sequence descriptors in the peptide space; (B) the final ensemble of descriptors, the descriptors hydrophobic moment, index of b-sheet formation, rate between charged and hydrophobic residues and a-helix propensity were ruled out. doi:10.1371/journal.pone.0051444.gCS-AMPPred: The Cysteine-Stabilized AMPs PredictorFigure 2. Distribution of sequence descriptor values. The left box in each panel corresponds to the AMPs. All descriptors have statistical differences when compared to the non-antimicrobial data set, with a critical value of 0.05. The observed p-values are as follows: charge (,2.2e-16), hydrophobicity (2.169e-06), flexibility (,2.2e-16), index of a-helix formation (,2.2e-16) and index of loop formation (2.908e-10). doi:10.1371/journal.pone.0051444.gsubsequently the descriptors with redundant behavior or with little influence on variance were removed. Therefore, 18297096 a two sided Wilcoxon-Mann-Whitney non-parametric test was applied forverifying the differences between the sequence descriptors in the PS and NS sets, with a critical value of 0.05. The statistical analyses were done through the R package for statistical computing (http://www.r-project.org).Support Vector Machine’s Training and ValidationThree SVM models were developed through SVM Light [41], using the linear, polynomial and radial kernels. The training was done using the training set. An overview of the model’s accuracy was estimated through a 5-fold cross validation, taking into account only the training data set. Therefore, the models were challenged against the blind data set, where the following parameters were measured: Sensitivity TP |100 TPzFN ??SpecificityTN |100 TNzFP??AccuracyFigure 3. ROC curves for the CS-AMPPred models against the blind data set (BS1). doi:10.1371/journal.pone.0051444.gTPzTN |100 TPzTNzFNzFP??CS-AMPPred: The Cysteine-Stabilized AMPs PredictorTable 1. Evaluation of CS-AMPPred models against the individual cysteine-stabilized AMP classes and also PDB sequences which were not used in the data sets.a-defensins1 93.33 97.78 97.78 b-defensins1 96.83 95.24 96.83 CSab defensins1 81.36 77.12 77.12 Cyclotides1 70.34 81.36 83.05 Undefined1 84.13 79.37 80.95 PDB# 80.65 82.55 81.Model Linear Polynomial Radial#Antimicrobial Peptide Classes, values computed through equation 1 (Sensitivity). Non Antimicrobial Peptides, values computed through equation 2 (Specificity), using the 1364 sequences from PDB which were not included in NS. doi:10.1371/journal.pone.0051444.tTP |100 PPV TPzFP??(TP|TN){(FP|FN) MCC pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi.

N marinus Genome draft assembly WUSTL v.3.0 (March 2007). A ,1.7 kb DNA single band was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. Sequencing of plasmid DNA from several clones containing the 1.7 kb DNA fragment confirmed lamprey RPE65 identity. Lamprey RPE65 ORF was PCR amplified with Phusion Flash II DNA Polymerase and following primers: LamRPE65F: 59-AAAGCAACCGGTGATATCATGGCTACTTGTGTGGAGCACCCTG-39 and LamRPE65R: 59-ACGCGTGGATCCGATATCCTAGTGCTTCGAGCTCTCCTTGAAC-39. A 1.5 kb PCR product was cloned into the EcoRV site of pVITRO2-hygro-mcs expression vector (Invivogen) with cloned bovine CRALBP using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with hygromycin. The resulting construct was confirmed by sequencing. For lamprey LRAT cloning, total RNA from lamprey RPE (10 mg) was treated with TerminatorTM 59-Phosphate-Dependent Exonuclease (EPICENTRE Biotechnologies) to degrade ribosomal RNA. The remaining mRNA was Calciferol chemical information concentrated using RNA Clean and ConcentratorTM-5 (Zymo Research) and reverse transcribed by SMARTScribeTM Reverse Transcriptase as previously described for RPE65. The first-strand reaction product was diluted with Tricine-EDTA buffer to 100 ml. The same touchdown PCR program as for RPE65 amplification was used in a reaction mix containing PhusionTM Flash High-Fidelity PCR Master Mix (Finnzymes) with Universal Primer A Mix (UPM), long (0.4 mM), short (2 mM) 1480666 and lamprey LRAT 59-RACE primer 59AGCGTTGGTGAGGAGGTGTCCTGGT-39 (designed from lamprey partial genomic DNA sequence from contig9067, Title Loaded From File Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 1.1 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. The cloned 1.1 kb DNA fragment was sequenced and confirmed to contain lamprey LRAT. The LRAT ORF was PCR amplified with Phusion Flash II DNA Polymerase and the following primers: LamLRAT2_InF_For: 59-CACCCGGGCACCATGCAAAGGAGCAGCATTGTGCAGGGC-39 and LamLRAT2_InFRev: 59TGCTCCTAGGCGTACTTACCCAGCCATCCACAGGAGGAT-39, producing an 852 bp PCR product. This DNA fragment was inserted into NcoI and BsiWI sites of pVITRO3-mcs expression vector (Invivogen) using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with hygromycin. The sequencing of the resulting pVITRO3_LRAT construct confirmed that the inserted DNA fragment was LRAT in the correct orientation and position. Lamprey BCMO was cloned from the same RNA sample and using the same conditions as for LRAT cloning, with Universal Primer A Mix (UPM) and lamBCMO 59-RACE primer 59GGTCGTCGTTATTAGACGACGTTGGGAGCG -39 (designed from partial genomic DNA sequence from contig6156, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 2.0 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) accordingto the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with kanamycin. Two clones were sequence confirmed to contain 2 variants of lamprey BCMO. The.N marinus Genome draft assembly WUSTL v.3.0 (March 2007). A ,1.7 kb DNA single band was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. Sequencing of plasmid DNA from several clones containing the 1.7 kb DNA fragment confirmed lamprey RPE65 identity. Lamprey RPE65 ORF was PCR amplified with Phusion Flash II DNA Polymerase and following primers: LamRPE65F: 59-AAAGCAACCGGTGATATCATGGCTACTTGTGTGGAGCACCCTG-39 and LamRPE65R: 59-ACGCGTGGATCCGATATCCTAGTGCTTCGAGCTCTCCTTGAAC-39. A 1.5 kb PCR product was cloned into the EcoRV site of pVITRO2-hygro-mcs expression vector (Invivogen) with cloned bovine CRALBP using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with hygromycin. The resulting construct was confirmed by sequencing. For lamprey LRAT cloning, total RNA from lamprey RPE (10 mg) was treated with TerminatorTM 59-Phosphate-Dependent Exonuclease (EPICENTRE Biotechnologies) to degrade ribosomal RNA. The remaining mRNA was concentrated using RNA Clean and ConcentratorTM-5 (Zymo Research) and reverse transcribed by SMARTScribeTM Reverse Transcriptase as previously described for RPE65. The first-strand reaction product was diluted with Tricine-EDTA buffer to 100 ml. The same touchdown PCR program as for RPE65 amplification was used in a reaction mix containing PhusionTM Flash High-Fidelity PCR Master Mix (Finnzymes) with Universal Primer A Mix (UPM), long (0.4 mM), short (2 mM) 1480666 and lamprey LRAT 59-RACE primer 59AGCGTTGGTGAGGAGGTGTCCTGGT-39 (designed from lamprey partial genomic DNA sequence from contig9067, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 1.1 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. The cloned 1.1 kb DNA fragment was sequenced and confirmed to contain lamprey LRAT. The LRAT ORF was PCR amplified with Phusion Flash II DNA Polymerase and the following primers: LamLRAT2_InF_For: 59-CACCCGGGCACCATGCAAAGGAGCAGCATTGTGCAGGGC-39 and LamLRAT2_InFRev: 59TGCTCCTAGGCGTACTTACCCAGCCATCCACAGGAGGAT-39, producing an 852 bp PCR product. This DNA fragment was inserted into NcoI and BsiWI sites of pVITRO3-mcs expression vector (Invivogen) using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with hygromycin. The sequencing of the resulting pVITRO3_LRAT construct confirmed that the inserted DNA fragment was LRAT in the correct orientation and position. Lamprey BCMO was cloned from the same RNA sample and using the same conditions as for LRAT cloning, with Universal Primer A Mix (UPM) and lamBCMO 59-RACE primer 59GGTCGTCGTTATTAGACGACGTTGGGAGCG -39 (designed from partial genomic DNA sequence from contig6156, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 2.0 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) accordingto the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with kanamycin. Two clones were sequence confirmed to contain 2 variants of lamprey BCMO. The.

Nd 95uC for 5 minutes (termination of cDNA synthesis). Immediately after, the samples were cooled down and stored at 220uC.Plasma MeasurementsCholesterol level was measured in duplicate using the kit Cholesterol Chod-Pap (Roche Diagnostics GmbH, Germany) in accordance with the protocol of the manufacturer. Calibrator (C.f.a.s from Roche Diagnostics GmbH) and controls (Wako Control Serum I and II from Wako Chemicals GmbH, Germany) were included in the analysis. The intra- and interassay coefficients of variation were 3.6 and 6.0 , respectively.Statistical AnalysisAll statistical analyses were performed using SPSS 20.0 (IBM Corp., USA). Graphs have been constructed using GraphPad Prism version 5.0c for Mac OS X (GraphPad Software Inc., USA). All results were log-transformed to obtain Gaussian distribution as confirmed by one-sample ��-Sitosterol ��-D-glucoside Kolmogorov-Smirnov test. Comparisons between the different groups were performed by Student’s t-test for independent samples and Bonferroni correction of p-values was applied by multiplying the acquired p-values. Univariate linearIdentifying the Optimal Reference GenesThe optimal reference genes for the study were selected from a panel of twelve common endogenous control genes (prefabricated panel of primer-mixes from TATAA Biocenter, Sweden). All candidate genes were tested by quantitative realFDG and Gene Expression in Murine AtherosclerosisFigure 1. CT, fused PET/CT, and PET images. A Contrast-enhanced CT image. B Fused PET/CT image. C PET image. All images are in sagittal view. doi:10.1371/journal.pone.0050908.gregression was performed between the molecular markers (gene expression) and SUVmean-values and p-values were Bonferroni corrected. Markers with significant correlation (R) were subsequently included in a multivariate linear regression model with stepwise backward elimination of the least significant marker. Data are reported as mean6SEM (standard error of mean) unless otherwise indicated and p,0.05 was considered statistically significant.Results Uptake ofF-FDG in the Vessel WallThe uptake of order NT 157 18F-FDG measured using PET and gamma counting, respectively, is shown in Figures 3a and 3b. The uptake of 18F-FDG measured using PET (Figure 3a) was not significantly different in the groups receiving normal chow for 24 and 32 weeks compared to the 0 weeks group. However, the 8 and 16 weeks groups showed a small decrease in the uptake compared to the 0 weeks group with a fold change of 0.84 (p = 0.013) and 0.78 (p = 0.0012), respectively. The high-fat Western diet had a marked effect upon the uptake of 18F-FDG measured by PET and from 16 weeks, SUVmean was significantly higher compared to 0 weeks group. The fold change was 1.73 after 16 weeks (p = 0.0011), 1.82 after 24 weeks (p,0.001) and 2.23 after 32 weeks (p,0.001) compared to 0 weeks.When comparing mice on high-fat Western diet with mice on normal chow of the same age, a significant higher 18F-FDG uptake measured by PET was seen after 16 weeks of dieting compared to non-dieting (2.21 fold; p,0.001). The 18F-FDG uptake was 2.02 fold higher at 24 weeks on diet compared to non-diet (p,0.001). At 32 weeks, a 2.29 fold higher level was seen (p,0.001). The 18F-FDG uptake measured by gamma counting showed the same pattern (Figure 3b) as measured by PET, except, the uptake did not differ significantly in the chow-fed groups compared to the 0 weeks group. The high-fat Western diet had a marked effect upon the 18F-FDG uptake measured by gamma counting from 16 weeks.Nd 95uC for 5 minutes (termination of cDNA synthesis). Immediately after, the samples were cooled down and stored at 220uC.Plasma MeasurementsCholesterol level was measured in duplicate using the kit Cholesterol Chod-Pap (Roche Diagnostics GmbH, Germany) in accordance with the protocol of the manufacturer. Calibrator (C.f.a.s from Roche Diagnostics GmbH) and controls (Wako Control Serum I and II from Wako Chemicals GmbH, Germany) were included in the analysis. The intra- and interassay coefficients of variation were 3.6 and 6.0 , respectively.Statistical AnalysisAll statistical analyses were performed using SPSS 20.0 (IBM Corp., USA). Graphs have been constructed using GraphPad Prism version 5.0c for Mac OS X (GraphPad Software Inc., USA). All results were log-transformed to obtain Gaussian distribution as confirmed by one-sample Kolmogorov-Smirnov test. Comparisons between the different groups were performed by Student’s t-test for independent samples and Bonferroni correction of p-values was applied by multiplying the acquired p-values. Univariate linearIdentifying the Optimal Reference GenesThe optimal reference genes for the study were selected from a panel of twelve common endogenous control genes (prefabricated panel of primer-mixes from TATAA Biocenter, Sweden). All candidate genes were tested by quantitative realFDG and Gene Expression in Murine AtherosclerosisFigure 1. CT, fused PET/CT, and PET images. A Contrast-enhanced CT image. B Fused PET/CT image. C PET image. All images are in sagittal view. doi:10.1371/journal.pone.0050908.gregression was performed between the molecular markers (gene expression) and SUVmean-values and p-values were Bonferroni corrected. Markers with significant correlation (R) were subsequently included in a multivariate linear regression model with stepwise backward elimination of the least significant marker. Data are reported as mean6SEM (standard error of mean) unless otherwise indicated and p,0.05 was considered statistically significant.Results Uptake ofF-FDG in the Vessel WallThe uptake of 18F-FDG measured using PET and gamma counting, respectively, is shown in Figures 3a and 3b. The uptake of 18F-FDG measured using PET (Figure 3a) was not significantly different in the groups receiving normal chow for 24 and 32 weeks compared to the 0 weeks group. However, the 8 and 16 weeks groups showed a small decrease in the uptake compared to the 0 weeks group with a fold change of 0.84 (p = 0.013) and 0.78 (p = 0.0012), respectively. The high-fat Western diet had a marked effect upon the uptake of 18F-FDG measured by PET and from 16 weeks, SUVmean was significantly higher compared to 0 weeks group. The fold change was 1.73 after 16 weeks (p = 0.0011), 1.82 after 24 weeks (p,0.001) and 2.23 after 32 weeks (p,0.001) compared to 0 weeks.When comparing mice on high-fat Western diet with mice on normal chow of the same age, a significant higher 18F-FDG uptake measured by PET was seen after 16 weeks of dieting compared to non-dieting (2.21 fold; p,0.001). The 18F-FDG uptake was 2.02 fold higher at 24 weeks on diet compared to non-diet (p,0.001). At 32 weeks, a 2.29 fold higher level was seen (p,0.001). The 18F-FDG uptake measured by gamma counting showed the same pattern (Figure 3b) as measured by PET, except, the uptake did not differ significantly in the chow-fed groups compared to the 0 weeks group. The high-fat Western diet had a marked effect upon the 18F-FDG uptake measured by gamma counting from 16 weeks.

Ncreased? The nature of IT function has changed significantly more than the past two decades as organizations moved toward flatter, teambased and relational organizing models. This shift in work demands that IT experts create more than technical abilities. The literature on IT performance has largely ignored the effects of investing inside the soft abilities (interpersonal expertise and teamwork) that IT people today require to correctly operate in this new atmosphere (Hitt and Brynjolfsson, 1994; Brynjolfsson and Hitt, 2000). Without these softer expertise, it’s little wonder why IT professionals will not be totally engaged and seem to be functioning under their prospective. Employee engagement is defined as a positive, work-related state of mind exhibited by high levels of power, dedication, persistence, and delighted absorption (Schaufeli et al., 2002). In line with Schaufeli et al.’s (2002) theory of engagement, engagement is not conceptualized as a momentary and specific state, rather “a . . . persistent and pervasive affective-cognitive state not focused on any particular object, occasion, person, or behavior.” This study was created to understand which emotional and social competencies and organizational things relate for the engagement of IT experts. The analysis model was tested on a sample of 795 North American IT specialists employing structural equation modeling. The paper starts having a evaluation in the pertinent theoretical foundations and an explanation of your constructs utilized to articulate a research model and associated hypotheses on employee engagement. This can be followed by an examination on the study solutions deployed, and finally, an analysis and discussion with the findings, limitations, and implications for future study and practice.persistence even within the face of difficulties” (Schaufeli et al., 2002, p. 74).Interpersonal Atmosphere as an Antecedent to Leucomethylene blue (Mesylate) EngagementThe interpersonal environment is deemed to become a subset of your organizational environment ?defined because the employee’s perception in the practices, policies, and processes of an organization (Ostroff et al., 2003). Research has identified both direct (Corporate Leadership Council, 2004) and MedChemExpress CI-1011 indirect (Iacono and Weisband, 1997; Jarvenpaa et al., 1998) relationships between the organizational atmosphere and employee engagement, and closely related, employee commitment (Eisenberger et al., 1986). Even so, less study has focused especially on the significance in the interpersonal atmosphere. This paper claims that there’s a relationship amongst the IT professional’s perception of the interpersonal components of your organizational environment and employee engagement. Boyatzis (2013) claims that the interpersonal environment in an organization is comprised of 3 dimensions: shared vision, compassion, and overall constructive mood. These three dimensions had been employed inside the research model. Shared vision is defined because the degree to which the people in a relationship perceive that they have a shared vision, or preferred image of your future. It is actually proposed that shared vision will positively relate to engagement for the reason that when personnel have clear direction and self-confidence in themselves to attain that vision they are a lot more most likely to become engaged in their operate. Especially, the shared nature of a vision will elicit feelings that help the three sub constructs of engagement: excitement and enthusiasm for their perform (dedication), a sense of ownership and investment in their function (vigor), and increased absorpt.Ncreased? The nature of IT work has changed considerably more than the previous two decades as organizations moved toward flatter, teambased and relational organizing models. This shift in function demands that IT experts create more than technical abilities. The literature on IT efficiency has largely ignored the effects of investing within the soft skills (interpersonal capabilities and teamwork) that IT people today have to have to correctly operate within this new atmosphere (Hitt and Brynjolfsson, 1994; Brynjolfsson and Hitt, 2000). Without the need of these softer abilities, it can be tiny wonder why IT professionals are usually not completely engaged and seem to be functioning beneath their possible. Employee engagement is defined as a positive, work-related state of thoughts exhibited by high levels of energy, dedication, persistence, and delighted absorption (Schaufeli et al., 2002). In line with Schaufeli et al.’s (2002) theory of engagement, engagement is not conceptualized as a momentary and particular state, rather “a . . . persistent and pervasive affective-cognitive state not focused on any unique object, occasion, person, or behavior.” This analysis was developed to understand which emotional and social competencies and organizational components relate to the engagement of IT specialists. The research model was tested on a sample of 795 North American IT specialists applying structural equation modeling. The paper begins using a critique with the pertinent theoretical foundations and an explanation from the constructs used to articulate a analysis model and related hypotheses on employee engagement. This really is followed by an examination on the study procedures deployed, and finally, an analysis and discussion in the findings, limitations, and implications for future analysis and practice.persistence even inside the face of difficulties” (Schaufeli et al., 2002, p. 74).Interpersonal Environment as an Antecedent to EngagementThe interpersonal atmosphere is deemed to become a subset from the organizational environment ?defined because the employee’s perception of your practices, policies, and processes of an organization (Ostroff et al., 2003). Analysis has discovered both direct (Corporate Leadership Council, 2004) and indirect (Iacono and Weisband, 1997; Jarvenpaa et al., 1998) relationships in between the organizational environment and employee engagement, and closely related, employee commitment (Eisenberger et al., 1986). However, significantly less research has focused particularly on the value of the interpersonal environment. This paper claims that there is a relationship among the IT professional’s perception of the interpersonal components in the organizational environment and employee engagement. Boyatzis (2013) claims that the interpersonal environment in an organization is comprised of 3 dimensions: shared vision, compassion, and general positive mood. These three dimensions had been utilized in the research model. Shared vision is defined because the degree to which the individuals within a connection perceive that they have a shared vision, or preferred image from the future. It is actually proposed that shared vision will positively relate to engagement because when staff have clear direction and confidence in themselves to achieve that vision they’re a lot more probably to be engaged in their operate. Especially, the shared nature of a vision will elicit feelings that help the three sub constructs of engagement: excitement and enthusiasm for their work (dedication), a sense of ownership and investment in their function (vigor), and enhanced absorpt.

Ssions [35]. The required period of vernalization (for Arabidopsis accessions requiring this cue to trigger flowering) is typically much IQ1 longer that the moist chilling period required for Arabidopsis seed dormancy breakage. Yet the CASIN cost similarities between the two processes are striking. It is thus interesting to speculate that a similar polymorphism-based mechanism is the underlying basis for some of the variations in cold-requirements for dormancy breakage, and for the huge variation in the depth of seeddormancy. The mechanisms observed in the context of vernalization effects at the chromatin level certainly seem comparable to the gradual accumulation of H3K27me3 and simultaneous reduction of H3K4me3 that we observed on seed dormancy regulators during moist chilling of seeds. It is conceivable that germination competence is reached at a certain threshold ratio of active to repressive marks on dormancy regulators, and that germination proceeds only when genes specifying positive germination regulators are activated. This would provide a quantitative means to measure the extent of cold exposure as a result of the output of the ratio of activating and repressive marks. Interestingly, we detected both histone marks at the corresponding loci for maturation/dormancy-related genes in our sampling population in non-dormant seeds before their transfer to germination conditions (Figs. 4 and S2). H3K27me3 thus gradually replaces H3K4me3 on the major dormancy regulators, until no or very little H3K4me3 remains detectable in seedlings. It is however unlikely that these would represent so-called bivalent marks, which are found in mammalian embryonic stem cells [38], as evidence 18297096 for this is scarce in plants [39]. Very little is known about the mechanistic aspects of the interactions between different histone modifications in plants. By combining our findings with H3K4me3 profiling in prc2 mutants [13], we found that this mark needs to be replaced by H3K27me3 in order to be removed as many of the dormancy regulators that we investigated such as ABI3, DOG1, and FLC, still show H3K4me3 in seedlings upon loss of H3K27me3 [13] (Fig. S3). This is remarkable as only a small portion of PRC2-target genes in the genome show this gain in H3K4me3 upon loss of PRC2, suggesting that its activity is necessary to replace the activating mark and effect the termination of gene expression. PRC2-mediated dormancy control appears to take place at the level of the embryo, as seeds with homozygous PRC2-defective endosperm but heterozygous embryos exhibit germination behavior that is indistinguishable from that of wild-type seeds [13]. Therefore, we expanded our nChIP analyses to isolated embryos from seeds that had been exposed to the dormancy-terminating treatment (14 d of moist chilling). The histone profiles of the embryos strongly resembled those of whole seeds (Fig. S4). Therefore the dynamic change from the activating to the repressive state very likely takes place in the embryo during dormancy breakage.Changes in Histone Methylation of the ABI3 Gene, a Major Regulator of Life Cycle Transitions, are Evolutionarily ConservedHaving found that major dormancy regulators such as ABI3 are transcriptionally regulated at the chromatin level in Arabidopsis, we asked whether the same is true for an evolutionarily distant species, the gymnosperm yellow-cedar (Callitropsis nootkatensis). The seeds of this conifer species are deeply dormant at maturity and upon dispersal they typica.Ssions [35]. The required period of vernalization (for Arabidopsis accessions requiring this cue to trigger flowering) is typically much longer that the moist chilling period required for Arabidopsis seed dormancy breakage. Yet the similarities between the two processes are striking. It is thus interesting to speculate that a similar polymorphism-based mechanism is the underlying basis for some of the variations in cold-requirements for dormancy breakage, and for the huge variation in the depth of seeddormancy. The mechanisms observed in the context of vernalization effects at the chromatin level certainly seem comparable to the gradual accumulation of H3K27me3 and simultaneous reduction of H3K4me3 that we observed on seed dormancy regulators during moist chilling of seeds. It is conceivable that germination competence is reached at a certain threshold ratio of active to repressive marks on dormancy regulators, and that germination proceeds only when genes specifying positive germination regulators are activated. This would provide a quantitative means to measure the extent of cold exposure as a result of the output of the ratio of activating and repressive marks. Interestingly, we detected both histone marks at the corresponding loci for maturation/dormancy-related genes in our sampling population in non-dormant seeds before their transfer to germination conditions (Figs. 4 and S2). H3K27me3 thus gradually replaces H3K4me3 on the major dormancy regulators, until no or very little H3K4me3 remains detectable in seedlings. It is however unlikely that these would represent so-called bivalent marks, which are found in mammalian embryonic stem cells [38], as evidence 18297096 for this is scarce in plants [39]. Very little is known about the mechanistic aspects of the interactions between different histone modifications in plants. By combining our findings with H3K4me3 profiling in prc2 mutants [13], we found that this mark needs to be replaced by H3K27me3 in order to be removed as many of the dormancy regulators that we investigated such as ABI3, DOG1, and FLC, still show H3K4me3 in seedlings upon loss of H3K27me3 [13] (Fig. S3). This is remarkable as only a small portion of PRC2-target genes in the genome show this gain in H3K4me3 upon loss of PRC2, suggesting that its activity is necessary to replace the activating mark and effect the termination of gene expression. PRC2-mediated dormancy control appears to take place at the level of the embryo, as seeds with homozygous PRC2-defective endosperm but heterozygous embryos exhibit germination behavior that is indistinguishable from that of wild-type seeds [13]. Therefore, we expanded our nChIP analyses to isolated embryos from seeds that had been exposed to the dormancy-terminating treatment (14 d of moist chilling). The histone profiles of the embryos strongly resembled those of whole seeds (Fig. S4). Therefore the dynamic change from the activating to the repressive state very likely takes place in the embryo during dormancy breakage.Changes in Histone Methylation of the ABI3 Gene, a Major Regulator of Life Cycle Transitions, are Evolutionarily ConservedHaving found that major dormancy regulators such as ABI3 are transcriptionally regulated at the chromatin level in Arabidopsis, we asked whether the same is true for an evolutionarily distant species, the gymnosperm yellow-cedar (Callitropsis nootkatensis). The seeds of this conifer species are deeply dormant at maturity and upon dispersal they typica.

O APAP-induced liver injury in miceAfter urine profiling, an increased abundance in protein peaks was observed for mice treated with 275 and 350 mg/kg APAP compared to control and AMAP (Figure 2A). In total, 66 protein peaks in the WCX beads spectra, and 75 protein peaks in the C8 beads spectra were detected as significantly different between all APAP treatments and control. These proteins presented with increasing peak I-BRD9 web intensities in urine of mice with elevated plasma ALT values (Figure 2B). Most protein peaks were only detectable in urine of mice with relatively severe APAP-induced liver injury. However, two proteins of 15.9 and 16.8 kDa, later identified as SOD1 and CaM, respectively, were observed in the C8 beads spectra at low plasma ALT levels. The eleven differentiating proteins that were identified using vMALDI LTQ are depicted in Table 2. LC-MS/MS analysis confirmed the presence of these proteins and additionally retrieved the identity of the 16.8 kDa protein, which was not found using vMALDI-LTQ (Table 3). Besides SOD1 and CaM, also peak intensities of fragments of CA3 correlated closely with plasma ALT values (Figure 2C ), and therefore these 3 proteins were investigated further. To confirm the presence of CA3 and SOD1 in urine by a specific antibody, we used Western blot analysis, as shown in Figure 3A. Whereas CA3 could be detected only in urine of mice with high plasma ALT (.3500 U/L) values, SOD1 was associated with minor elevations in plasma ALT (.100 U/L) and it gradually amplified with increasing plasma ALT values. After measuring the intensities of the SOD1 signal in the Western blot, linear MedChemExpress 4EGI-1 regression analysis showed a significant correlation between urinary SOD1 and plasma ALT levels (Figure 3B). The third potential biomarker, CaM, was confirmed with an immunocapUrinary Biomarkers of Acetaminophen HepatotoxicityFigure 3. Identification of CA3, SOD1 and CaM in mouse urine. Western blots show the relation between urinary SOD1 and CA3, and plasma ALT levels in individual mice (n = 13; panel A), of which urinary SOD1 intensity on Western blot was analyzed by linear regression analysis (B). Immunoprecipitation demonstrated the specific protein profile of CaM, i.e. the mass peak for CaM at 16.8 kDa (CaM+H) and its double and triple charged form (CaM+2H 24272870 and CaM+3H), in mouse urine after APAP treatment (C). ALT: alanine aminotransferase; APAP: acetaminophen; CA3: carbonic anhydrase 3; CaM: calmodulin; SOD1: superoxide distmutase 1. doi:10.1371/journal.pone.0049524.gDiscussionThe present study was designed to identify novel biomarkers in urine for acute DILI by using APAP as model compound. Applying multiple proteomics techniques allowed us to identify twelve proteins related to APAP-induced liver injury. 15857111 For the firsttime, we report the presence of CA3, SOD1 and CaM in urine to be related to APAP-induced liver injury, of which CaM had never been linked to liver injury before. Of these proteins, principally SOD1 and CaM closely associated with plasma ALT, as observed by proteomic profiling and antibody-based methods. CA3 fragments showed a good correlation with plasma ALT withUrinary Biomarkers of Acetaminophen HepatotoxicityFigure 4. Detection of SOD1, CA3 and CaM in human urine samples. Presence of CA3 and SOD1 was assessed by Western blot in urine samples of masterpool control (I), severe APAP intoxication sample 1 (II) and 2 (III) and a positive control (IV) (panel A). Using an ELISA assay, the urinary concentration of C.O APAP-induced liver injury in miceAfter urine profiling, an increased abundance in protein peaks was observed for mice treated with 275 and 350 mg/kg APAP compared to control and AMAP (Figure 2A). In total, 66 protein peaks in the WCX beads spectra, and 75 protein peaks in the C8 beads spectra were detected as significantly different between all APAP treatments and control. These proteins presented with increasing peak intensities in urine of mice with elevated plasma ALT values (Figure 2B). Most protein peaks were only detectable in urine of mice with relatively severe APAP-induced liver injury. However, two proteins of 15.9 and 16.8 kDa, later identified as SOD1 and CaM, respectively, were observed in the C8 beads spectra at low plasma ALT levels. The eleven differentiating proteins that were identified using vMALDI LTQ are depicted in Table 2. LC-MS/MS analysis confirmed the presence of these proteins and additionally retrieved the identity of the 16.8 kDa protein, which was not found using vMALDI-LTQ (Table 3). Besides SOD1 and CaM, also peak intensities of fragments of CA3 correlated closely with plasma ALT values (Figure 2C ), and therefore these 3 proteins were investigated further. To confirm the presence of CA3 and SOD1 in urine by a specific antibody, we used Western blot analysis, as shown in Figure 3A. Whereas CA3 could be detected only in urine of mice with high plasma ALT (.3500 U/L) values, SOD1 was associated with minor elevations in plasma ALT (.100 U/L) and it gradually amplified with increasing plasma ALT values. After measuring the intensities of the SOD1 signal in the Western blot, linear regression analysis showed a significant correlation between urinary SOD1 and plasma ALT levels (Figure 3B). The third potential biomarker, CaM, was confirmed with an immunocapUrinary Biomarkers of Acetaminophen HepatotoxicityFigure 3. Identification of CA3, SOD1 and CaM in mouse urine. Western blots show the relation between urinary SOD1 and CA3, and plasma ALT levels in individual mice (n = 13; panel A), of which urinary SOD1 intensity on Western blot was analyzed by linear regression analysis (B). Immunoprecipitation demonstrated the specific protein profile of CaM, i.e. the mass peak for CaM at 16.8 kDa (CaM+H) and its double and triple charged form (CaM+2H 24272870 and CaM+3H), in mouse urine after APAP treatment (C). ALT: alanine aminotransferase; APAP: acetaminophen; CA3: carbonic anhydrase 3; CaM: calmodulin; SOD1: superoxide distmutase 1. doi:10.1371/journal.pone.0049524.gDiscussionThe present study was designed to identify novel biomarkers in urine for acute DILI by using APAP as model compound. Applying multiple proteomics techniques allowed us to identify twelve proteins related to APAP-induced liver injury. 15857111 For the firsttime, we report the presence of CA3, SOD1 and CaM in urine to be related to APAP-induced liver injury, of which CaM had never been linked to liver injury before. Of these proteins, principally SOD1 and CaM closely associated with plasma ALT, as observed by proteomic profiling and antibody-based methods. CA3 fragments showed a good correlation with plasma ALT withUrinary Biomarkers of Acetaminophen HepatotoxicityFigure 4. Detection of SOD1, CA3 and CaM in human urine samples. Presence of CA3 and SOD1 was assessed by Western blot in urine samples of masterpool control (I), severe APAP intoxication sample 1 (II) and 2 (III) and a positive control (IV) (panel A). Using an ELISA assay, the urinary concentration of C.

S transformed into BL21(DE3) cells and expressed alone. Protein expression was induced at culture OD600 = 0.6?.8 with 0.5 mM IPTG and conducted at 16uC for 18 h. Cells were harvested by centrifugation, resuspended in 15 ml lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl) per L of culture, and mixed together prior to treatment with lysozyme (5 mg per L of culture), Complete Protease Inhibitor Tablet (Roche), 1 mM PMSF. Cells were then sonicated, and lysates treated with DNaseI, clarified by centrifugation and filtration, and supplemented with 1 mM DTT and 0.1 Triton-X 100.Figure 1. The IPP complex forms a stable, monodisperse, heterotrimeric complex. A) Schematic diagram of the IPP complex: Integrin-linked kinase (ILK; magenta), PINCH (green) and Parvin (blue). ILK is the hub of the complex, and binds the LIM1 domain of PINCH-1 via its N-terminal ankyrin-repeat domain (ARD), and the C-terminal calponin homology (CH2) domain of a-parvin via its C-terminal pseudokinase domain (pKD) to form the IPPmin complex. The 14 residue inter-domain linker in ILK is shown. The lengths of the proteinsProtein PurificationLysates were applied to glutathione-agarose 4B beads (GE Healthcare) at 4uC and MedChemExpress IQ-1 collected by gravity flow. The flowSAXS Analysis of the IPP ComplexFigure 2. SAXS analysis for IPPmin reveals a globular heterotrimeric complex. A) SAXS intensity profiles (logarithmic) for four concentrations of the IPPmin complex. B) Linearity of Guinier plots with manual selection of Guinier region. The Rg values are presented in Table 1. Automatic Guinier analysis performed in AutoRG [29], which is ASP015K manufacturer consistent with the analysis shown here, is presented in the Supporting Information. C) Normalized pair distribution functions P(R) calculated automatically with AutoGNOM [30]. D) Dimensionless Kratky plots support a globular shape. doi:10.1371/journal.pone.0055591.gthrough sample was collected, and reapplied to the glutathione column a total of three times. The beads were washed three times with 10 column volumes (CV) of lysis buffer plus 1 mM DTT, and the column flow stopped before addition of freshly prepared elution buffer (15 mM reduced glutathione in lysis buffer, 1 mM DTT). Beads were incubated with elution buffer for 5 minutes, and the eluate collected. Elution was performed with 7?0 fractions of elution buffer, and the evaluated by SDS-PAGE. Elution fractions containing IPP complex were pooled. His-tagged recombinant 18325633 TEV protease was added at a final concentration of 0.01?.1 mg/ml and incubated overnight at 4uC, to remove the GST- and (His)-tags. The sample was then diluted for injection onto a 1 mL Mono Q column (GE Healthcare) to 50 mM Tris, pH 7.5, 30 mM NaCl, 1 mM DTT. A shallow gradient over 80 CV from 3 to 13 Buffer B (50 mM Tris pH 7.5, 1 M NaCl, 1 mM DTT) was applied in order to differentially elute GST from IPP protein, and 2 ml fractions collected. To remove remaining contaminating (His)-TEV protease and/or GST, the fractions containing IPP complex proteins (as determined by SDS-PAGE) were incubated with 50 ml of glutathione-agarose 4B plus 50 ml NiAgarose beads for 1 h at 4uC. The sample was then concentrated to 2 ml in a Centrifugal Filtration Unit (Millipore) and further purified by size-exclusion chromatography (Superdex 200 prep grade 16/60; GE Healthcare) equilibrated in 25 mM Tris, pH 7.5, 150 mM NaCl, 1 mM DTT. Fractions containing IPP proteins were pooled and concentrated to a final concentration of 7.0 mg/ml and filtered through a 0.S transformed into BL21(DE3) cells and expressed alone. Protein expression was induced at culture OD600 = 0.6?.8 with 0.5 mM IPTG and conducted at 16uC for 18 h. Cells were harvested by centrifugation, resuspended in 15 ml lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl) per L of culture, and mixed together prior to treatment with lysozyme (5 mg per L of culture), Complete Protease Inhibitor Tablet (Roche), 1 mM PMSF. Cells were then sonicated, and lysates treated with DNaseI, clarified by centrifugation and filtration, and supplemented with 1 mM DTT and 0.1 Triton-X 100.Figure 1. The IPP complex forms a stable, monodisperse, heterotrimeric complex. A) Schematic diagram of the IPP complex: Integrin-linked kinase (ILK; magenta), PINCH (green) and Parvin (blue). ILK is the hub of the complex, and binds the LIM1 domain of PINCH-1 via its N-terminal ankyrin-repeat domain (ARD), and the C-terminal calponin homology (CH2) domain of a-parvin via its C-terminal pseudokinase domain (pKD) to form the IPPmin complex. The 14 residue inter-domain linker in ILK is shown. The lengths of the proteinsProtein PurificationLysates were applied to glutathione-agarose 4B beads (GE Healthcare) at 4uC and collected by gravity flow. The flowSAXS Analysis of the IPP ComplexFigure 2. SAXS analysis for IPPmin reveals a globular heterotrimeric complex. A) SAXS intensity profiles (logarithmic) for four concentrations of the IPPmin complex. B) Linearity of Guinier plots with manual selection of Guinier region. The Rg values are presented in Table 1. Automatic Guinier analysis performed in AutoRG [29], which is consistent with the analysis shown here, is presented in the Supporting Information. C) Normalized pair distribution functions P(R) calculated automatically with AutoGNOM [30]. D) Dimensionless Kratky plots support a globular shape. doi:10.1371/journal.pone.0055591.gthrough sample was collected, and reapplied to the glutathione column a total of three times. The beads were washed three times with 10 column volumes (CV) of lysis buffer plus 1 mM DTT, and the column flow stopped before addition of freshly prepared elution buffer (15 mM reduced glutathione in lysis buffer, 1 mM DTT). Beads were incubated with elution buffer for 5 minutes, and the eluate collected. Elution was performed with 7?0 fractions of elution buffer, and the evaluated by SDS-PAGE. Elution fractions containing IPP complex were pooled. His-tagged recombinant 18325633 TEV protease was added at a final concentration of 0.01?.1 mg/ml and incubated overnight at 4uC, to remove the GST- and (His)-tags. The sample was then diluted for injection onto a 1 mL Mono Q column (GE Healthcare) to 50 mM Tris, pH 7.5, 30 mM NaCl, 1 mM DTT. A shallow gradient over 80 CV from 3 to 13 Buffer B (50 mM Tris pH 7.5, 1 M NaCl, 1 mM DTT) was applied in order to differentially elute GST from IPP protein, and 2 ml fractions collected. To remove remaining contaminating (His)-TEV protease and/or GST, the fractions containing IPP complex proteins (as determined by SDS-PAGE) were incubated with 50 ml of glutathione-agarose 4B plus 50 ml NiAgarose beads for 1 h at 4uC. The sample was then concentrated to 2 ml in a Centrifugal Filtration Unit (Millipore) and further purified by size-exclusion chromatography (Superdex 200 prep grade 16/60; GE Healthcare) equilibrated in 25 mM Tris, pH 7.5, 150 mM NaCl, 1 mM DTT. Fractions containing IPP proteins were pooled and concentrated to a final concentration of 7.0 mg/ml and filtered through a 0.

Mmittee,Cell CultureMouse podocyte cell culture. Podocytes between passage 10 and 15 were maintained in RPMI 1640 medium supplementGlomerular Endothelial Cell InjuryFigure 2. Functional characterization of ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. A: Ratio of urinary 1081537 protein/ creatinine; B: Body weight; C: Ratio of kidney /body weight; D: Serum creatinine and E: Systolic blood pressure in NS- and ADR-injected mice. Twoway ANOVA; n = 5, data are means 6 SD. doi:10.1371/journal.pone.0055027.gwith 10 fetal bovine serum (FBS) and 1 streptomycin/ penicillin solution [33]. Cells were propagated in 10 U/ml murine IFNc at 33uC and then differentiated by culture for 7 days at 37uCin the absence of IFNc [34]. Differentiated podocytes showed prominent cytoplasmic processes and expressed synaptopodin.Glomerular Endothelial Cell InjuryFigure 3. Extracellular 4-IBP custom synthesis matrix products in ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. Collagen IV (A ) and fibronectin (E ) staining sections from NS- (A, C, E G) and ADR-injected (B, D, F H) wild type (A, B, E F) and eNOS-deficient (C, D, G H) kidneys at day 28. Graph showing quantification of the area of staining for collagen IV and fibronectin. One-way ANOVA, n = 5, data are means 6 SD. ***: vs WT NS, WT ADR and eNOS KO NS, P,0.001. doi:10.1371/journal.pone.0055027.gMouse microvascular endothelial cell (MMEC) culture and generation of eNOS over-expression MMECs. MMECswere purchased from ATCC (Manassas, VA ) and cultured in 5 CO2 atmosphere at 37uC in Dulbecco’s modified MedChemExpress MK 8931 Eagle’s medium (Life Technologies BRL, Gaithersburg, MD) containing 10 FBS. To generate eNOS over-expression in MMECs, MMECs were transfected with pcDNA3-eNOS-GFP plasmid (Addgene Plasmid 22444) using FuGENE HD (Roche, Hawthorn, Austrialia). Seven days after transfection, two rounds of fluorescence activated cell sorting (FACS) (FACsDiva, Flowcore, Clayton, Australia) were employed to obtain eNOS-GFP-positive and eNOS-GFP-negative MMECs. MMEC conditioned mediae. NOS-GFP-positive and eNOS-GFP-negative MMECs were separately seeded intowell-tissue culture plates at a density of 36106 cells/well. The cells were incubated for 12 hours then washed three times with PBS prior to fresh media being added to the cells. The supernatant was collected 24 hours later and is referred to as eNOS-GFPpositive and eNOS-GFP-negative media, respectively. TNF-a treated podocyte cell culture. Podocytes were seeded in 6 well-plates at a density of 16106 cells per well and cultured initially at 33uC (propagating condition) prior being cultured at 37uC (differentiating condition). Five days after differentiation had commenced, conditioned media was added to the cells. The medium was changed to 0.1 FBS on day 7. Podocytes were stimulated with 10 ng/ml TNF- a for 36 hours before harvesting.Glomerular Endothelial Cell InjuryFigure 4. Glomerular endothelial cell and podocyte damage in ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. Time course of glomerular endothelial cell CD31 (A ) and podocyte synaptopodin (F ) staining sections from NS-treated kidneys at day 28 (A F), ADR-treated kidneys at days 3 (B G), 7 (C H), 14 (D I) and 28 (E J). Graph showing quantification of the area of CD31(K) and synaptopodin (L) staining. One-way ANOVA, n = 5, data are means 6 SD. Vs NS day 28, * P,0.05; **P,0.01; ***P,0.001. doi:10.1371/journal.pone.0055027.gHistological assessmentA coronal slice of kidney tissue was fixed in 4 par.Mmittee,Cell CultureMouse podocyte cell culture. Podocytes between passage 10 and 15 were maintained in RPMI 1640 medium supplementGlomerular Endothelial Cell InjuryFigure 2. Functional characterization of ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. A: Ratio of urinary 1081537 protein/ creatinine; B: Body weight; C: Ratio of kidney /body weight; D: Serum creatinine and E: Systolic blood pressure in NS- and ADR-injected mice. Twoway ANOVA; n = 5, data are means 6 SD. doi:10.1371/journal.pone.0055027.gwith 10 fetal bovine serum (FBS) and 1 streptomycin/ penicillin solution [33]. Cells were propagated in 10 U/ml murine IFNc at 33uC and then differentiated by culture for 7 days at 37uCin the absence of IFNc [34]. Differentiated podocytes showed prominent cytoplasmic processes and expressed synaptopodin.Glomerular Endothelial Cell InjuryFigure 3. Extracellular matrix products in ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. Collagen IV (A ) and fibronectin (E ) staining sections from NS- (A, C, E G) and ADR-injected (B, D, F H) wild type (A, B, E F) and eNOS-deficient (C, D, G H) kidneys at day 28. Graph showing quantification of the area of staining for collagen IV and fibronectin. One-way ANOVA, n = 5, data are means 6 SD. ***: vs WT NS, WT ADR and eNOS KO NS, P,0.001. doi:10.1371/journal.pone.0055027.gMouse microvascular endothelial cell (MMEC) culture and generation of eNOS over-expression MMECs. MMECswere purchased from ATCC (Manassas, VA ) and cultured in 5 CO2 atmosphere at 37uC in Dulbecco’s modified Eagle’s medium (Life Technologies BRL, Gaithersburg, MD) containing 10 FBS. To generate eNOS over-expression in MMECs, MMECs were transfected with pcDNA3-eNOS-GFP plasmid (Addgene Plasmid 22444) using FuGENE HD (Roche, Hawthorn, Austrialia). Seven days after transfection, two rounds of fluorescence activated cell sorting (FACS) (FACsDiva, Flowcore, Clayton, Australia) were employed to obtain eNOS-GFP-positive and eNOS-GFP-negative MMECs. MMEC conditioned mediae. NOS-GFP-positive and eNOS-GFP-negative MMECs were separately seeded intowell-tissue culture plates at a density of 36106 cells/well. The cells were incubated for 12 hours then washed three times with PBS prior to fresh media being added to the cells. The supernatant was collected 24 hours later and is referred to as eNOS-GFPpositive and eNOS-GFP-negative media, respectively. TNF-a treated podocyte cell culture. Podocytes were seeded in 6 well-plates at a density of 16106 cells per well and cultured initially at 33uC (propagating condition) prior being cultured at 37uC (differentiating condition). Five days after differentiation had commenced, conditioned media was added to the cells. The medium was changed to 0.1 FBS on day 7. Podocytes were stimulated with 10 ng/ml TNF- a for 36 hours before harvesting.Glomerular Endothelial Cell InjuryFigure 4. Glomerular endothelial cell and podocyte damage in ADR-induced nephropathy in C57BL/6 mice with eNOS deficiency. Time course of glomerular endothelial cell CD31 (A ) and podocyte synaptopodin (F ) staining sections from NS-treated kidneys at day 28 (A F), ADR-treated kidneys at days 3 (B G), 7 (C H), 14 (D I) and 28 (E J). Graph showing quantification of the area of CD31(K) and synaptopodin (L) staining. One-way ANOVA, n = 5, data are means 6 SD. Vs NS day 28, * P,0.05; **P,0.01; ***P,0.001. doi:10.1371/journal.pone.0055027.gHistological assessmentA coronal slice of kidney tissue was fixed in 4 par.

T measure of attachment avoidance. We hypothesized that attachment avoidance would be associated with higher fasting basal levels of glucose, and that the indicators of tension and stress would not account for that association.FIGURE 1 | The scatterplot depicts the association TPPU chemical information between attachment avoidance and fasting basal MedChemExpress PD150606 glucose level. Consistent with our hypothesis, the higher the participants’ attachment avoidance score, the higher their fasting basal glucose level. Also, as the attachment avoidance score increased, the association between attachment avoidance and fasting basal glucose level increased in its relative magnitude. Note that the area within the light dashed lines represents the normal range of fasting basal glucose levels. By contrast, the heavy dashed line near the top depicts the level at which fasting basal glucose levels become clinically significant.r(58) = 0.37, p < 0.01. After completing these questionnaires, participants completed a socio-demographic questionnaire and were debriefed and thanked.Results and DiscussionParticipants' fasting basal glucose level was examined using a curve estimation regression analysis (estimating linear and quadratic relations), in which participants' attachment avoidance score served as the predictor, and their fasting basal glucose level served as the outcome measure. Estimating a linear association between attachment avoidance and fasting basal glucose level, we observed that the higher the participants' attachment avoidance score, the greater their fasting basal glucose level, F(1, 58) = 12.89, = 0.43, R2 = 0.18, p < 0.001. Adding the quadratic estimation yield marginally significant increment in the association, t(57) = 1.96, p = 0.055, boosting the to 0.48 and the R2 to 0.23 (see Figure 1). When time of testing was included in the regression model, there was no effect of time of testing, t(57) = 1.24, p = 0.22, and the model estimating linear and quadratic effects of attachment avoidance on fasting basal glucose remained significant, F (3,55) = 6.28, p = 0.001, R2 = 0.21. No similar associations were observed between fasting basal glucose and attachment anxiety. In line with our prediction, women who tend to avoid depending on others for support had greater fasting basal levels of glucose in their blood than their more socially oriented counterparts. The higher levels of basal blood glucose found in highly avoidant individuals may serve as a metabolic reservoir that provides people high in attachment avoidance with the needed energy for rapid, independent responses to unpredictable contextualMaterials and Methods ParticipantsStudy 2 was part of ongoing longitudinal research conducted at Ruppin Academic Center (Cloninger and Zohar, 2011). Twohundred-eighty-five Israeli participants (143 women and 142 men), ranging in age from 42 to 90 years (Mdn = 58), volunteered to participate in the study, which included a free medical examination at a well-known medical facility (Mor Institute for Medical Data Ltd). Study 2 was approved by the Hillel Yaffe Medical Center's Helsinki committee (granted to RC; HSR # 42\2007).Measures and Procedure The study spanned two sessions. In the first session, participants, who were recruited by a series of public lectures, mailbox pamphlets, and word of mouth, were individually invited to Ruppin Academic Center for a morning of interview, self-report, and cognitive testing. Attachment orientations were assessed with a Hebrew-language questionnaire de.T measure of attachment avoidance. We hypothesized that attachment avoidance would be associated with higher fasting basal levels of glucose, and that the indicators of tension and stress would not account for that association.FIGURE 1 | The scatterplot depicts the association between attachment avoidance and fasting basal glucose level. Consistent with our hypothesis, the higher the participants' attachment avoidance score, the higher their fasting basal glucose level. Also, as the attachment avoidance score increased, the association between attachment avoidance and fasting basal glucose level increased in its relative magnitude. Note that the area within the light dashed lines represents the normal range of fasting basal glucose levels. By contrast, the heavy dashed line near the top depicts the level at which fasting basal glucose levels become clinically significant.r(58) = 0.37, p < 0.01. After completing these questionnaires, participants completed a socio-demographic questionnaire and were debriefed and thanked.Results and DiscussionParticipants' fasting basal glucose level was examined using a curve estimation regression analysis (estimating linear and quadratic relations), in which participants' attachment avoidance score served as the predictor, and their fasting basal glucose level served as the outcome measure. Estimating a linear association between attachment avoidance and fasting basal glucose level, we observed that the higher the participants' attachment avoidance score, the greater their fasting basal glucose level, F(1, 58) = 12.89, = 0.43, R2 = 0.18, p < 0.001. Adding the quadratic estimation yield marginally significant increment in the association, t(57) = 1.96, p = 0.055, boosting the to 0.48 and the R2 to 0.23 (see Figure 1). When time of testing was included in the regression model, there was no effect of time of testing, t(57) = 1.24, p = 0.22, and the model estimating linear and quadratic effects of attachment avoidance on fasting basal glucose remained significant, F (3,55) = 6.28, p = 0.001, R2 = 0.21. No similar associations were observed between fasting basal glucose and attachment anxiety. In line with our prediction, women who tend to avoid depending on others for support had greater fasting basal levels of glucose in their blood than their more socially oriented counterparts. The higher levels of basal blood glucose found in highly avoidant individuals may serve as a metabolic reservoir that provides people high in attachment avoidance with the needed energy for rapid, independent responses to unpredictable contextualMaterials and Methods ParticipantsStudy 2 was part of ongoing longitudinal research conducted at Ruppin Academic Center (Cloninger and Zohar, 2011). Twohundred-eighty-five Israeli participants (143 women and 142 men), ranging in age from 42 to 90 years (Mdn = 58), volunteered to participate in the study, which included a free medical examination at a well-known medical facility (Mor Institute for Medical Data Ltd). Study 2 was approved by the Hillel Yaffe Medical Center's Helsinki committee (granted to RC; HSR # 42\2007).Measures and Procedure The study spanned two sessions. In the first session, participants, who were recruited by a series of public lectures, mailbox pamphlets, and word of mouth, were individually invited to Ruppin Academic Center for a morning of interview, self-report, and cognitive testing. Attachment orientations were assessed with a Hebrew-language questionnaire de.