N marinus Genome draft assembly WUSTL v.3.0 (March 2007). A ,1.7 kb DNA single band was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. Sequencing of plasmid DNA from several clones containing the 1.7 kb DNA fragment confirmed lamprey RPE65 identity. Lamprey RPE65 ORF was PCR amplified with Phusion Flash II DNA Polymerase and following primers: LamRPE65F: 59-AAAGCAACCGGTGATATCATGGCTACTTGTGTGGAGCACCCTG-39 and LamRPE65R: 59-ACGCGTGGATCCGATATCCTAGTGCTTCGAGCTCTCCTTGAAC-39. A 1.5 kb PCR product was cloned into the EcoRV site of pVITRO2-hygro-mcs expression vector (Invivogen) with cloned bovine CRALBP using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with hygromycin. The resulting construct was confirmed by sequencing. For lamprey LRAT cloning, total RNA from lamprey RPE (10 mg) was treated with TerminatorTM 59-Phosphate-Dependent Exonuclease (EPICENTRE Biotechnologies) to degrade ribosomal RNA. The remaining mRNA was Calciferol chemical information concentrated using RNA Clean and ConcentratorTM-5 (Zymo Research) and reverse transcribed by SMARTScribeTM Reverse Transcriptase as previously described for RPE65. The first-strand reaction product was diluted with Tricine-EDTA buffer to 100 ml. The same touchdown PCR program as for RPE65 amplification was used in a reaction mix containing PhusionTM Flash High-Fidelity PCR Master Mix (Finnzymes) with Universal Primer A Mix (UPM), long (0.4 mM), short (2 mM) 1480666 and lamprey LRAT 59-RACE primer 59AGCGTTGGTGAGGAGGTGTCCTGGT-39 (designed from lamprey partial genomic DNA sequence from contig9067, Title Loaded From File Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 1.1 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. The cloned 1.1 kb DNA fragment was sequenced and confirmed to contain lamprey LRAT. The LRAT ORF was PCR amplified with Phusion Flash II DNA Polymerase and the following primers: LamLRAT2_InF_For: 59-CACCCGGGCACCATGCAAAGGAGCAGCATTGTGCAGGGC-39 and LamLRAT2_InFRev: 59TGCTCCTAGGCGTACTTACCCAGCCATCCACAGGAGGAT-39, producing an 852 bp PCR product. This DNA fragment was inserted into NcoI and BsiWI sites of pVITRO3-mcs expression vector (Invivogen) using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with hygromycin. The sequencing of the resulting pVITRO3_LRAT construct confirmed that the inserted DNA fragment was LRAT in the correct orientation and position. Lamprey BCMO was cloned from the same RNA sample and using the same conditions as for LRAT cloning, with Universal Primer A Mix (UPM) and lamBCMO 59-RACE primer 59GGTCGTCGTTATTAGACGACGTTGGGAGCG -39 (designed from partial genomic DNA sequence from contig6156, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 2.0 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) accordingto the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with kanamycin. Two clones were sequence confirmed to contain 2 variants of lamprey BCMO. The.N marinus Genome draft assembly WUSTL v.3.0 (March 2007). A ,1.7 kb DNA single band was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. Sequencing of plasmid DNA from several clones containing the 1.7 kb DNA fragment confirmed lamprey RPE65 identity. Lamprey RPE65 ORF was PCR amplified with Phusion Flash II DNA Polymerase and following primers: LamRPE65F: 59-AAAGCAACCGGTGATATCATGGCTACTTGTGTGGAGCACCCTG-39 and LamRPE65R: 59-ACGCGTGGATCCGATATCCTAGTGCTTCGAGCTCTCCTTGAAC-39. A 1.5 kb PCR product was cloned into the EcoRV site of pVITRO2-hygro-mcs expression vector (Invivogen) with cloned bovine CRALBP using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with hygromycin. The resulting construct was confirmed by sequencing. For lamprey LRAT cloning, total RNA from lamprey RPE (10 mg) was treated with TerminatorTM 59-Phosphate-Dependent Exonuclease (EPICENTRE Biotechnologies) to degrade ribosomal RNA. The remaining mRNA was concentrated using RNA Clean and ConcentratorTM-5 (Zymo Research) and reverse transcribed by SMARTScribeTM Reverse Transcriptase as previously described for RPE65. The first-strand reaction product was diluted with Tricine-EDTA buffer to 100 ml. The same touchdown PCR program as for RPE65 amplification was used in a reaction mix containing PhusionTM Flash High-Fidelity PCR Master Mix (Finnzymes) with Universal Primer A Mix (UPM), long (0.4 mM), short (2 mM) 1480666 and lamprey LRAT 59-RACE primer 59AGCGTTGGTGAGGAGGTGTCCTGGT-39 (designed from lamprey partial genomic DNA sequence from contig9067, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 1.1 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) according to the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plates supplemented with kanamycin. The cloned 1.1 kb DNA fragment was sequenced and confirmed to contain lamprey LRAT. The LRAT ORF was PCR amplified with Phusion Flash II DNA Polymerase and the following primers: LamLRAT2_InF_For: 59-CACCCGGGCACCATGCAAAGGAGCAGCATTGTGCAGGGC-39 and LamLRAT2_InFRev: 59TGCTCCTAGGCGTACTTACCCAGCCATCCACAGGAGGAT-39, producing an 852 bp PCR product. This DNA fragment was inserted into NcoI and BsiWI sites of pVITRO3-mcs expression vector (Invivogen) using the In-Fusion PCR cloning system (Clontech) following manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with hygromycin. The sequencing of the resulting pVITRO3_LRAT construct confirmed that the inserted DNA fragment was LRAT in the correct orientation and position. Lamprey BCMO was cloned from the same RNA sample and using the same conditions as for LRAT cloning, with Universal Primer A Mix (UPM) and lamBCMO 59-RACE primer 59GGTCGTCGTTATTAGACGACGTTGGGAGCG -39 (designed from partial genomic DNA sequence from contig6156, Petromyzon marinus Genome draft assembly WUSTL v.3.0 (March 2007)). A single 2.0 kb DNA band was obtained. This PCR product was cloned into pCR-Blunt vector (Invitrogen) accordingto the manufacturer’s instructions, transformed into TOP10 competent cells, and grown on agar plate supplemented with kanamycin. Two clones were sequence confirmed to contain 2 variants of lamprey BCMO. The.